SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma20g11094): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma20g11094): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma20g11094

Feature Type:gene_model
Chromosome:Gm20
Start:15639452
stop:15645453
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma20g11094
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G09520AT Annotation by Michelle Graham. TAIR10: Cofactor-independent phosphoglycerate mutase | chr4:6024970-6026751 REVERSE LENGTH=492 SoyBaseE_val: 6.00E-35ISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004619GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphoglycerate mutase activity SoyBaseN/AISS
GO:0046872GO-mf Annotation by Michelle Graham. GO Molecular Function: metal ion binding SoyBaseN/AISS
PTHR10641Panther MYB-RELATED JGI ISS
PF10143PFAM 2,3-bisphosphoglycerate-independent phosphoglycerate mutase JGI ISS
UniRef100_F4JK17UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cofactor-independent phosphoglycerate mutase n=1 Tax=Arabidopsis thaliana RepID=F4JK17_ARATH SoyBaseE_val: 3.00E-32ISS
UniRef100_I1KWP3UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KWP3_SOYBN SoyBaseE_val: 5.00E-41ISS

Expression Patterns of Glyma20g11094
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma20g11094 not represented in the dataset
Glyma20g11094 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma20g11094 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.20g047400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma20g11094
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma20g11094
>Glyma20g11094.1   sequence type=CDS   gene model=Glyma20g11094   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTGGCTTTCAATTTTTCTTCTTCTCTGTTTTCAAGGTCTTGCGAGATGTGGAAAGAGTTGCAGACTAAGGTGGCTGAATTACCTAAGGCCAAACCTCAAAAGAGGAAACTACACCAAGGAAGAGGAGGAAACTATTATCAAGCTGCACCGACATCTGGGTAATAGGTATGCAACAGAGCATAGATGTAGAGTAGTTGTTAAAGGACCAAATCTGAGTGGAAATATATCAGGAACAGAGCCATTGAAGGACAACCACATACTTTTGAAAGTAGAAGCTTTAGATGATTCTCATGAAGCAAGGAACATTGTTGCTGTTGTTAATGAGTTGTCCAAGGAAATAACAAAAAATTTGGTTTCTCATCCTGTGAATGCTAAATGTACTGCAAAAGGGAAGAACATAGCAAATTTAGTCCTTTTAACCCATTTATGTATCCTTCTACTTCAAAGGAAAACACATCAAATATGTAGCAATCATTAG
Predicted protein sequences of Glyma20g11094
>Glyma20g11094.1   sequence type=predicted peptide   gene model=Glyma20g11094   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MWLSIFLLLCFQGLARCGKSCRLRWLNYLRPNLKRGNYTKEEEETIIKLHRHLGNRYATEHRCRVVVKGPNLSGNISGTEPLKDNHILLKVEALDDSHEARNIVAVVNELSKEITKNLVSHPVNAKCTAKGKNIANLVLLTHLCILLLQRKTHQICSNH*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo