SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma20g10030

Feature Type:gene_model
Chromosome:Gm20
Start:13837851
stop:13844635
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma20g10030
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G16890AT Annotation by Michelle Graham. TAIR10: ubiquitin-conjugating enzyme 36 | chr1:5776550-5778327 REVERSE LENGTH=153 SoyBaseE_val: 1.00E-109ISS
GO:0006511GO-bp Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0010039GO-bp Annotation by Michelle Graham. GO Biological Process: response to iron ion SoyBaseN/AISS
GO:0010053GO-bp Annotation by Michelle Graham. GO Biological Process: root epidermal cell differentiation SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0031372GO-cc Annotation by Michelle Graham. GO Cellular Compartment: UBC13-MMS2 complex SoyBaseN/AISS
GO:0004842GO-mf Annotation by Michelle Graham. GO Molecular Function: ubiquitin-protein ligase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0016881GO-mf Annotation by Michelle Graham. GO Molecular Function: acid-amino acid ligase activity SoyBaseN/AISS
KOG0417 KOG Ubiquitin-protein ligase JGI ISS
PTHR24067Panther UBIQUITIN-CONJUGATING ENZYME E2 JGI ISS
PTHR24067:SF30Panther SUBFAMILY NOT NAMED JGI ISS
PF00179PFAM Ubiquitin-conjugating enzyme JGI ISS
UniRef100_I1NE09UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NE09_SOYBN SoyBaseE_val: 1.00E-107ISS
UniRef100_Q9FZ48UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ubiquitin-conjugating enzyme E2 36 n=2 Tax=Arabidopsis RepID=UBC36_ARATH SoyBaseE_val: 5.00E-107ISS

Expression Patterns of Glyma20g10030
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma20g10030 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.12g161200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma20g10030
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma20g10030
>Glyma20g10030.1   sequence type=CDS   gene model=Glyma20g10030   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCAACAGCAACCTCCCTCGAAGAATCATCAAGGAAACGCAGCGTTTGCTCAGTGAGCCAGCACCAGGAATTAGTGCCTCCCCTTCTGAAGAGAATATGCGATATTTCAATGTGATGATCCTTGGGCCAACCCAGTCGCCTTATGAAGGAGGAGTTTTCAAGTTAGAACTATTTTTGCCAGAAGAATATCCAATGGCTGCTCCAAAGGTTAGGTTTCTAACAAAAATATATCATCCAAACATTGATAAGCTTGGCAGGATTTGTCTTGATATTCTGAAAGATAAGTGGAGTCCTGCCCTTCAGATCCGCACTGTTCTACTAAGCATTCAAGCTCTATTAAGTGCACCAAACCCAGATGATCCACTTTCTGAGAACATTGCCAAGCATTGGAAATCTAATGAGGCTGAGGCTGTCGAAACAGCGAAGGAATGGACCCGATTATATGCTAGTGGCGTCTGA
Predicted protein sequences of Glyma20g10030
>Glyma20g10030.1   sequence type=predicted peptide   gene model=Glyma20g10030   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MANSNLPRRIIKETQRLLSEPAPGISASPSEENMRYFNVMILGPTQSPYEGGVFKLELFLPEEYPMAAPKVRFLTKIYHPNIDKLGRICLDILKDKWSPALQIRTVLLSIQALLSAPNPDDPLSENIAKHWKSNEAEAVETAKEWTRLYASGV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo