|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT3G13580 | AT | Annotation by Michelle Graham. TAIR10: Ribosomal protein L30/L7 family protein | chr3:4433809-4435109 FORWARD LENGTH=244 | SoyBase | E_val: 5.00E-31 | ISS |
| GO:0006412 | GO-bp | Annotation by Michelle Graham. GO Biological Process: translation | SoyBase | N/A | ISS |
| GO:0005622 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: intracellular | SoyBase | N/A | ISS |
| GO:0005737 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm | SoyBase | N/A | ISS |
| GO:0005840 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: ribosome | SoyBase | N/A | ISS |
| GO:0009507 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast | SoyBase | N/A | ISS |
| GO:0015934 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: large ribosomal subunit | SoyBase | N/A | ISS |
| GO:0016020 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: membrane | SoyBase | N/A | ISS |
| GO:0022625 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cytosolic large ribosomal subunit | SoyBase | N/A | ISS |
| GO:0022626 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cytosolic ribosome | SoyBase | N/A | ISS |
| GO:0003735 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome | SoyBase | N/A | ISS |
| PTHR11524 | Panther | 60S RIBOSOMAL PROTEIN L7 | JGI | ISS | |
| PF00327 | PFAM | Ribosomal protein L30p/L7e | JGI | ISS | |
| UniRef100_B9RUS1 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: 60S ribosomal protein L7, putative n=1 Tax=Ricinus communis RepID=B9RUS1_RICCO | SoyBase | E_val: 3.00E-29 | ISS |
| UniRef100_F6GXJ2 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=1 Tax=Vitis vinifera RepID=F6GXJ2_VITVI | SoyBase | E_val: 3.00E-31 | ISS |
|
Glyma20g08610 not represented in the dataset |
Glyma20g08610 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma20g08610.1 sequence type=CDS gene model=Glyma20g08610 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGTACACAATATTAGAAGAAGATGATACAACAATTTTCAATGGTGTATTTCTCAAAGGTAACAAAGCCACAATGAACATGCTGCACATAGTTGAGCCCTATGTGACTTATGGATACCCAAATCTTAAGAGTGTGAAAGAACTTCTTTACAAGAGAGGGTATGGAAAGCTAAACAAGCAAAGGACTTCTCTAATTGACAACTCCATCATTGAGCAGCTATCTGCAAATATCATTTATTGTATTGAGATCACACCACTAGTTTCTAGGATTCCTTCGGCTAGGGAAGCAAAACTTAAAAGGCAAGCATTATATGCTAAAGCTCATTATCGAAGTGAGCCAAGAGACAGAAACAACAACAATAGGGCCAGGGGTCAAAATAGCAAACCAGGGGAATCCTTTTCTGTTATGAAAAAGCCTATATATATGTAA
>Glyma20g08610.1 sequence type=predicted peptide gene model=Glyma20g08610 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MYTILEEDDTTIFNGVFLKGNKATMNMLHIVEPYVTYGYPNLKSVKELLYKRGYGKLNKQRTSLIDNSIIEQLSANIIYCIEITPLVSRIPSAREAKLKRQALYAKAHYRSEPRDRNNNNRARGQNSKPGESFSVMKKPIYM*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||