|
A newer version of this gene model can be found here:
Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
---|---|---|---|---|---|
AT1G65260 | AT | Annotation by Michelle Graham. TAIR10: plastid transcriptionally active 4 | chr1:24236329-24240428 FORWARD LENGTH=330 | SoyBase | E_val: 2.00E-17 | ISS |
GO:0010027 | GO-bp | Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization | SoyBase | N/A | ISS |
GO:0016050 | GO-bp | Annotation by Michelle Graham. GO Biological Process: vesicle organization | SoyBase | N/A | ISS |
GO:0009295 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: nucleoid | SoyBase | N/A | ISS |
GO:0009507 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast | SoyBase | N/A | ISS |
GO:0009508 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plastid chromosome | SoyBase | N/A | ISS |
GO:0009534 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid | SoyBase | N/A | ISS |
GO:0009535 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane | SoyBase | N/A | ISS |
GO:0009570 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma | SoyBase | N/A | ISS |
GO:0009941 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope | SoyBase | N/A | ISS |
GO:0016020 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: membrane | SoyBase | N/A | ISS |
PF04012 | PFAM | PspA/IM30 family | JGI | ISS | |
UniRef100_G7JEX0 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Membrane-associated 30 kDa protein n=2 Tax=Medicago truncatula RepID=G7JEX0_MEDTR | SoyBase | E_val: 7.00E-19 | ISS |
UniRef100_UPI000233E6F6 | UniRef | Annotation by Michelle Graham. Best UniRef hit: UPI000233E6F6 related cluster n=1 Tax=unknown RepID=UPI000233E6F6 | SoyBase | E_val: 8.00E-23 | ISS |
Glyma20g08406 not represented in the dataset |
Glyma20g08406 not represented in the dataset |
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
Corresponding Name | Annotation Version | Evidence | Comments |
---|
Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma20g08406.1 sequence type=CDS gene model=Glyma20g08406 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high TTGCGGCTTCGAGAGGAAGAGGAAGAGGAGGGGGAAGAGGATTTGGAGCGCGAGGGAGAACGGGACCAAGAAAGGGAGCGTGAGCGAGAGGAGGAATGGGAGTCGGAGGGGGAAGAGGAGCGAGAGGAGGAGCCAAAAATGGAACTGGAGGGAGAGCGACGACCTCGCCCAGCACTATTTGGGAATCATGTTGGAGTAATGAATGTAACTATTGTTTTTTCTCAACAGCTTTTGGAGAGCAAGATACAGGAGGCAAAGTCAAATAAAGATACCCTCAAAGCAAGAGCTCAGTCTGCAAAGACTTCAACCATAGTTAGCGAGATGGTGGGCAATATCAACACAAGCAATGCCCTTGCAGCTTTTGATAAGATGGAGGAAAAGGGTTAG
>Glyma20g08406.1 sequence type=predicted peptide gene model=Glyma20g08406 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high LRLREEEEEEGEEDLEREGERDQEREREREEEWESEGEEEREEEPKMELEGERRPRPALFGNHVGVMNVTIVFSQQLLESKIQEAKSNKDTLKARAQSAKTSTIVSEMVGNINTSNALAAFDKMEEKG*
Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||