Glyma20g07985 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma20g07985

Feature Type:	gene_model
Chromosome:	Gm20
Start:	10922728
stop:	10927205
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma20g07985

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G52140	AT	Annotation by Michelle Graham. TAIR10: tetratricopeptide repeat (TPR)-containing protein \| chr3:19333232-19341295 FORWARD LENGTH=1403	SoyBase	E_val: 3.00E-35	ISS
GO:0006094	GO-bp	Annotation by Michelle Graham. GO Biological Process: gluconeogenesis	SoyBase	N/A	ISS
GO:0007010	GO-bp	Annotation by Michelle Graham. GO Biological Process: cytoskeleton organization	SoyBase	N/A	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0010498	GO-bp	Annotation by Michelle Graham. GO Biological Process: proteasomal protein catabolic process	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
PTHR23172	Panther	AUXILIN/CYCLIN G-ASSOCIATED KINASE-RELATED	JGI		ISS
UniRef100_B9RHH9	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Eukaryotic translation initiation factor 3 subunit, putative n=1 Tax=Ricinus communis RepID=B9RHH9_RICCO	SoyBase	E_val: 6.00E-33	ISS
UniRef100_UPI0002338EC4	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI0002338EC4 related cluster n=1 Tax=unknown RepID=UPI0002338EC4	SoyBase	E_val: 8.00E-42	ISS

Expression Patterns of Glyma20g07985

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma20g07985 not represented in the dataset	Glyma20g07985 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma20g07985 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma20g07985

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma20g07985

Limit To All Plant Sequences

>Glyma20g07985.1   sequence type=CDS   gene model=Glyma20g07985   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCAAAGAGACTGGAATGAAGAGCTGCAGTCTTGTAGAGAATTTCCTTGTACATCTCCTCAGGAGAGGATTTTGCGGGATAGGGCACTTTATAAAGTGACATCAGACTTTGTTGATGTAGCTATTAATGGTGCTATTGGAGTGATCAGTGGTTGCATTCCTCCGATAAACCCGACTAACCCTGAATGCTTTCACATCCTGTTTACCAAACATTATGTTCTTTGGCCAGAATGTGGTTGGCAGCCAGTGTCTCTGACAGATATGATTACCTCTTCTGCAGTTAAAAAAGTGTATAGAAAAGCAAATTTATGTATTCACCCAGATAAAGTTCAACAGAAAGGTGCTACTCTTGAACAGAAATACACAGCGGAGAAGGTTTTTGACATTCTTAAGCAGATTCTTTTTCCCTATAACGTTGAACGCTCTACGGTCAATGTACAAATTTTAAATGTTCATGATTCCCTAAGGTACTTAGATCAACTTGGAATAGCATCCTGCTACAGCACTAAAGTCTATTGCAGGCAAACTTTAATTGGAGGGAACTATGGCCTTCTCAATACCACCACCTTTGCTCCCAATCCTGACTACTACAGTGCAGTTTTGTGGCATCGGTTAATGGGAAAGAAGGTTCTTGCGGTCTCAAGTGATGTTCATATTAAAGACTTTTACCTACAGTTAGGAAATGTAAGTAGAAGTTAA

Predicted protein sequences of Glyma20g07985

Limit To All Plant Sequences

>Glyma20g07985.1   sequence type=predicted peptide   gene model=Glyma20g07985   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MQRDWNEELQSCREFPCTSPQERILRDRALYKVTSDFVDVAINGAIGVISGCIPPINPTNPECFHILFTKHYVLWPECGWQPVSLTDMITSSAVKKVYRKANLCIHPDKVQQKGATLEQKYTAEKVFDILKQILFPYNVERSTVNVQILNVHDSLRYLDQLGIASCYSTKVYCRQTLIGGNYGLLNTTTFAPNPDYYSAVLWHRLMGKKVLAVSSDVHIKDFYLQLGNVSRS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain