SoyBase
SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research
SoyBase
SoyBase transitions to NEW site on 10/1/2024
|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT4G33650 | AT | Annotation by Michelle Graham. TAIR10: dynamin-related protein 3A | chr4:16161073-16166587 FORWARD LENGTH=808 | SoyBase | E_val: 3.00E-112 | ISS |
| GO:0000266 | GO-bp | Annotation by Michelle Graham. GO Biological Process: mitochondrial fission | SoyBase | N/A | ISS |
| GO:0006626 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein targeting to mitochondrion | SoyBase | N/A | ISS |
| GO:0009640 | GO-bp | Annotation by Michelle Graham. GO Biological Process: photomorphogenesis | SoyBase | N/A | ISS |
| GO:0009658 | GO-bp | Annotation by Michelle Graham. GO Biological Process: chloroplast organization | SoyBase | N/A | ISS |
| GO:0009791 | GO-bp | Annotation by Michelle Graham. GO Biological Process: post-embryonic development | SoyBase | N/A | ISS |
| GO:0009793 | GO-bp | Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy | SoyBase | N/A | ISS |
| GO:0009845 | GO-bp | Annotation by Michelle Graham. GO Biological Process: seed germination | SoyBase | N/A | ISS |
| GO:0009909 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of flower development | SoyBase | N/A | ISS |
| GO:0009933 | GO-bp | Annotation by Michelle Graham. GO Biological Process: meristem structural organization | SoyBase | N/A | ISS |
| GO:0010162 | GO-bp | Annotation by Michelle Graham. GO Biological Process: seed dormancy process | SoyBase | N/A | ISS |
| GO:0010182 | GO-bp | Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0010228 | GO-bp | Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem | SoyBase | N/A | ISS |
| GO:0016559 | GO-bp | Annotation by Michelle Graham. GO Biological Process: peroxisome fission | SoyBase | N/A | ISS |
| GO:0016567 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein ubiquitination | SoyBase | N/A | ISS |
| GO:0019915 | GO-bp | Annotation by Michelle Graham. GO Biological Process: lipid storage | SoyBase | N/A | ISS |
| GO:0044375 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of peroxisome size | SoyBase | N/A | ISS |
| GO:0050826 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to freezing | SoyBase | N/A | ISS |
| GO:0005739 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion | SoyBase | N/A | ISS |
| GO:0005777 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: peroxisome | SoyBase | N/A | ISS |
| GO:0005829 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cytosol | SoyBase | N/A | ISS |
| GO:0009507 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast | SoyBase | N/A | ISS |
| GO:0009941 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope | SoyBase | N/A | ISS |
| GO:0016020 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: membrane | SoyBase | N/A | ISS |
| GO:0003924 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: GTPase activity | SoyBase | N/A | ISS |
| GO:0005515 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein binding | SoyBase | N/A | ISS |
| GO:0005525 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: GTP binding | SoyBase | N/A | ISS |
| GO:0035091 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: phosphatidylinositol binding | SoyBase | N/A | ISS |
| GO:0042802 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: identical protein binding | SoyBase | N/A | ISS |
| PTHR11566 | Panther | DYNAMIN | JGI | ISS | |
| PTHR11566:SF12 | Panther | DYNAMIN | JGI | ISS | |
| PF00350 | PFAM | Dynamin family | JGI | ISS | |
| PF01031 | PFAM | Dynamin central region | JGI | ISS | |
| UniRef100_A2Q1P0 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Dynamin central region; Dynamin n=1 Tax=Medicago truncatula RepID=A2Q1P0_MEDTR | SoyBase | E_val: 1.00E-129 | ISS |
| UniRef100_I1NDT7 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1NDT7_SOYBN | SoyBase | E_val: 0 | ISS |
|
Glyma20g06670 not represented in the dataset |
Glyma20g06670 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma20g06670.1 sequence type=CDS gene model=Glyma20g06670 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high TGCTTTTCCTGTTCACCCACTAACAAAACACCAACCCCTCACTGCCACATTAACCATCACTGGACTCAGTTGAACTTAGGTGCGAGTGTGCATATGTTTCAAGCTAAAACTGATAGGGAAGTGGGTGGGAACAAAGGTGTATCAAACAAGCAGATCCGACTTAAGATTTTTTCACCAAATGTTCTTGATATCACACTGGTAGATCTCCCAGGCATTACGAAGGTTCCTGTGGGTGACCAGCCTTCTGATATTGAAGCTCGCATCAGAACAATGATAATGTCATATATCAAAACTCCCACCTGTCTCATTCTAGTTGTCACACCAGCTAATTCGGATTTGGCTAATTCAGATGCTCTTCAGATGGCAGGGATTACTGATCCAGATGGTAATAGAACAATCGGTGTAATCACAAAGTTGGATATAATGGACAGAGCTACTGATGCCCGAAATTTGTTACTAGGAAAAGTTATTCCTCTCCGACTTGGTTATGTAGGTGTTGTAAACCGTAGTCAGGAGGATATTCAAATGAACCGGAGTATAAAGGATGCTGTTGTTGCTGAAGAGAATTTTTTCCACAATCGCATACAATGGTTTAGCAATAGTTGTAGTGTTCCTCAACTAGCAAAGAAGTTGAACCTGATTCTGACACAACATATAAAGGCTGTGCTACCTGGGCTGAGAGCACATATAAGCACTTCACTAGTTGCTGTTGTGAAGGAGCATGCAAGCTATGGAGAAATCACCGAGTCCAAGGCATGTGCTGATCAAGGTGCACTTCTCCTGAATATTCTTTCAAAATATTGTGAAGTGAACAAAAATAAAAATATTTTCATGAGACACGAAAATTAT
>Glyma20g06670.1 sequence type=predicted peptide gene model=Glyma20g06670 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high CFSCSPTNKTPTPHCHINHHWTQLNLGASVHMFQAKTDREVGGNKGVSNKQIRLKIFSPNVLDITLVDLPGITKVPVGDQPSDIEARIRTMIMSYIKTPTCLILVVTPANSDLANSDALQMAGITDPDGNRTIGVITKLDIMDRATDARNLLLGKVIPLRLGYVGVVNRSQEDIQMNRSIKDAVVAEENFFHNRIQWFSNSCSVPQLAKKLNLILTQHIKAVLPGLRAHISTSLVAVVKEHASYGEITESKACADQGALLLNILSKYCEVNKNKNIFMRHENY
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||
|
|
|
