Glyma20g04195 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma20g04195): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma20g04195): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma20g04195

Feature Type:	gene_model
Chromosome:	Gm20
Start:	4276541
stop:	4290118
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma20g04195

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G24800	AT	Annotation by Michelle Graham. TAIR10: basic leucine zipper 9 \| chr5:8515259-8516541 FORWARD LENGTH=277	SoyBase	E_val: 2.00E-27	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0071333	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular response to glucose stimulus	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0042803	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein homodimerization activity	SoyBase	N/A	ISS
GO:0043565	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding	SoyBase	N/A	ISS
GO:0046982	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein heterodimerization activity	SoyBase	N/A	ISS
GO:0046983	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein dimerization activity	SoyBase	N/A	ISS
PTHR22952	Panther	CAMP-RESPONSE ELEMENT BINDING PROTEIN-RELATED	JGI		ISS
PTHR22952:SF67	Panther	ATBZIP25/BZO2H4 (ARABIDOPSIS THALIANA BASIC LEUCIN	JGI		ISS
PF00170	PFAM	bZIP transcription factor	JGI		ISS
UniRef100_I1NC96	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NC96_SOYBN	SoyBase	E_val: 1.00E-69	ISS
UniRef100_Q0GPG5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: BZIP transcription factor bZIP105 n=1 Tax=Glycine max RepID=Q0GPG5_SOYBN	SoyBase	E_val: 3.00E-65	ISS

Expression Patterns of Glyma20g04195

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma20g04195 not represented in the dataset	Glyma20g04195 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma20g04195 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma20g04195

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma20g04195

Limit To All Plant Sequences

>Glyma20g04195.1   sequence type=CDS   gene model=Glyma20g04195   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCAGTTTTAATTTACATCTTAATTTTTATTTTCTACGTAGGATCTGGCCCTTTTGGAAATGATCCCTCTAAATTACAAAATAAAGATGTCAGAGCACACATTGGGATTCCTTCCTCACCTTCCATGCAAAACAAACCCATTGTCGCAATAAGGCCAACGACAAGTGGATCATCAGGAGAACAACCAGATGATGAGGAAGTGGAGGGAGAGATTAATAAGACTAAAAACATGACACCTGTTGATGCAAAACGAGTAAGGAGGATGCTTTCTAATAGGGAGTCAGACAGATGCTCAAGAAGGAGAAAGCAGACTCATTTAACTGAGCTGGGGACACAGGTCTCCCAATTACGAAGTGAAAATTCTTCGTTGTTAAAGCGATTCATTGATGTGAGCCCGAAATACAATAATGTTGCAATTGATAATAGAGTACTGAAAGTTGATGTTGAAACATTAAGAGTAAAGCTTCTAATGATACCTGCATCTCAAATAAAGTCTCGGCATTACGGAGAAGATAAACAGAAGGATGACAAATGTCACTAA

Predicted protein sequences of Glyma20g04195

Limit To All Plant Sequences

>Glyma20g04195.1   sequence type=predicted peptide   gene model=Glyma20g04195   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSVLIYILIFIFYVGSGPFGNDPSKLQNKDVRAHIGIPSSPSMQNKPIVAIRPTTSGSSGEQPDDEEVEGEINKTKNMTPVDAKRVRRMLSNRESDRCSRRRKQTHLTELGTQVSQLRSENSSLLKRFIDVSPKYNNVAIDNRVLKVDVETLRVKLLMIPASQIKSRHYGEDKQKDDKCH*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain