SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma20g03450): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma20g03450): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma20g03450

Feature Type:gene_model
Chromosome:Gm20
Start:3255237
stop:3256730
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma20g03450
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G10010AT Annotation by Michelle Graham. TAIR10: unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G64910.1); Has 33260 Blast hits to 16857 proteins in 1270 species: Archae - 88; Bacteria - 3040; Metazoa - 11915; Fungi - 3137; Plants - 1371; Viruses - 424; Other Eukaryotes - 13285 (source: NCBI BLink). | chr5:3128098-3131452 FORWARD L SoyBaseE_val: 3.00E-40ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005730GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleolus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
UniRef100_Q4AC14UniRef Annotation by Michelle Graham. Most informative UniRef hit: 117M18_4 n=1 Tax=Brassica rapa RepID=Q4AC14_BRACM SoyBaseE_val: 4.00E-40ISS
UniRef100_UPI000233DA8EUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233DA8E related cluster n=1 Tax=unknown RepID=UPI000233DA8E SoyBaseE_val: 5.00E-70ISS

Expression Patterns of Glyma20g03450
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma20g03450 not represented in the dataset
Glyma20g03450 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma20g03450 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma20g03450
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma20g03450
>Glyma20g03450.1   sequence type=CDS   gene model=Glyma20g03450   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GAAGATGAACTTGAACAGAGCACTGAAGTTCAAATTATATATCTAGCTGAGCCAAAGCCGGTCTTTAATGAATTTCATTGGGAATTAGATAAACTTGAGGAGTTTACTGATAAGCTTACAGAGGAGGAGGAGTTATCCGAAGATCAAAAGGATGCCTTGAAGGAATTTGTCAAGGGAAAGTTTTGTGAAGCTAAGAAAGCTAATAGAGAGGCAAGGGAAGCTCGGAAAAAAGCCATTGAAGAAATGAGTGAGGAAACTAAAGCTGCGTTTGAGAGTATGAGGTTTTATAAGTTCTACCCTGTTCAATCTCTAGATGCACATGATGTATCAAATGTTAAGGATGAATTCATTAGAACTATTAGATGA
Predicted protein sequences of Glyma20g03450
>Glyma20g03450.1   sequence type=predicted peptide   gene model=Glyma20g03450   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
EDELEQSTEVQIIYLAEPKPVFNEFHWELDKLEEFTDKLTEEEELSEDQKDALKEFVKGKFCEAKKANREAREARKKAIEEMSEETKAAFESMRFYKFYPVQSLDAHDVSNVKDEFIRTIR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo