SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma20g02600): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma20g02600): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma20g02600

Feature Type:gene_model
Chromosome:Gm20
Start:2160585
stop:2164303
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma20g02600
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G19840AT Annotation by Michelle Graham. TAIR10: phloem protein 2-A1 | chr4:10774336-10775701 FORWARD LENGTH=246 SoyBaseE_val: 9.00E-48ISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0009625GO-bp Annotation by Michelle Graham. GO Biological Process: response to insect SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009750GO-bp Annotation by Michelle Graham. GO Biological Process: response to fructose stimulus SoyBaseN/AISS
GO:0009963GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of flavonoid biosynthetic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0030246GO-mf Annotation by Michelle Graham. GO Molecular Function: carbohydrate binding SoyBaseN/AISS
GO:0043394GO-mf Annotation by Michelle Graham. GO Molecular Function: proteoglycan binding SoyBaseN/AISS
UniRef100_A2Q295UniRef Annotation by Michelle Graham. Most informative UniRef hit: Galactose-binding like n=1 Tax=Medicago truncatula RepID=A2Q295_MEDTR SoyBaseE_val: 4.00E-70ISS
UniRef100_I1NDE3UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NDE3_SOYBN SoyBaseE_val: 5.00E-123ISS

Expression Patterns of Glyma20g02600
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma20g02600 not represented in the dataset
Glyma20g02600 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma20g02600 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.20g021200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma20g02600
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma20g02600
>Glyma20g02600.1   sequence type=CDS   gene model=Glyma20g02600   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAGGGTGTCTACCATCCAAGCCAAATCCAGAAGATAATGGTTCAGCTTCCAGCAGCACAAATCGTTTCATGCTGTATGCGAGAGCACTTTCAATCACATGGGGAGACACTCCAGAATATTGGACATGGGTACAGCAGAAAGAAGAAGCAAGTGGCACGATAGTAGAGTTGGCTAAGTTGAAAAGTGTTTGCTGGCTAGAAGTGCATGGGAAATTTGACACTAGAAAGCTTTCAGCAGGAATTCTATATCAAGTGTTCTTTCTAATAATGTTGGAAGAATCATCTCAAGGGTGGGAAGTTCCAATAAATGTTGGATTTGTCCTTCCTGGAGGAAAGAGACAACAACATAAAGTAAATTTAAACGAGAAGTCAAGGGAGAGTTGGTTGGAGATTTTAGTAGGTGAGTTTGTGGCATCTAAAAAAGATGTTGGCGAGATGAAAATTTCTTTGTATGAATATGGTGGCATGTGGAAGACTGGGCTTGTCATCCAAGGTGTAGTCATTAAACCAAAGAACTAG
Predicted protein sequences of Glyma20g02600
>Glyma20g02600.1   sequence type=predicted peptide   gene model=Glyma20g02600   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGGCLPSKPNPEDNGSASSSTNRFMLYARALSITWGDTPEYWTWVQQKEEASGTIVELAKLKSVCWLEVHGKFDTRKLSAGILYQVFFLIMLEESSQGWEVPINVGFVLPGGKRQQHKVNLNEKSRESWLEILVGEFVASKKDVGEMKISLYEYGGMWKTGLVIQGVVIKPKN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo