Report for Sequence Feature Glyma20g02020
Feature Type: gene_model
Chromosome: Gm20
Start: 1531643
stop: 1540827
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma20g02020
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT5G12040 AT
Annotation by Michelle Graham. TAIR10: Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase family protein | chr5:3885162-3887772 FORWARD LENGTH=369
SoyBase E_val: 1.00E-115 ISS
GO:0006807 GO-bp
Annotation by Michelle Graham. GO Biological Process: nitrogen compound metabolic process
SoyBase N/A ISS
GO:0005829 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cytosol
SoyBase N/A ISS
GO:0009507 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: chloroplast
SoyBase N/A ISS
GO:0009570 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma
SoyBase N/A ISS
GO:0008270 GO-mf
Annotation by Michelle Graham. GO Molecular Function: zinc ion binding
SoyBase N/A ISS
GO:0016810 GO-mf
Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds
SoyBase N/A ISS
KOG0806
KOG
Carbon-nitrogen hydrolase
JGI ISS
PTHR23088 Panther
NITRILASE-RELATED
JGI ISS
PF00795 PFAM
Carbon-nitrogen hydrolase
JGI ISS
UniRef100_G7J8D4 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Omega-amidase NIT2 n=1 Tax=Medicago truncatula RepID=G7J8D4_MEDTR
SoyBase E_val: 7.00E-123 ISS
UniRef100_I1ND89 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1ND89_SOYBN
SoyBase E_val: 2.00E-162 ISS
Expression Patterns of Glyma20g02020
Gene expression representations made with eFP at the University of Toronto. Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE Gene model name correspondences to Glyma20g02020 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.20g016600 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma20g02020
Coding sequences of Glyma20g02020
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma20g02020.2 sequence type=CDS gene model=Glyma20g02020 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGTCTGCCACATCCGTCAACTCCGAACGAGCACTTGCCCCTCCTGCCATTCCCTTGCCCCCTCCCCCTCTCTCTAACTTCAAAATTGGCCTCTATCAACTCTCTGTCAGCCCCGACAAAGACAACAACATCGCCCATGCTCGCACCGCCATTCAGGATGATGCATCAAAGGGCGCCCAACTTGTTCTTTTGCCTGAAATTTGGAACAGTCCTTATTCCAATGATAGTTTTTCTGTCTACGCTGAGGATATTGACGCCGGTGCTTCTCCTTCCACTGCCATGCTATCTGAACTCTCTCGTATCTTGAAAATCACTATTGTTGGTTGTTTTATTCTAGAAAGTTATGGAGGTCTCTTGTACAACACTTGTTGCGTCTTTGGCACCGACGAAAACCTACTAGCCAAGGACCGCAAGATACATCTTTTTGATATTGACATCCCTGGGAAGATTACTTTTATTGAATCAAAAACTCTTACTGTTGGGGAGACTCTGACAATTGTGGACACAGAGGTTGGACGCATTAGCATAGGCATATGTTATGACATTCGATTTCCAGAACTAGCAATGATATATGTTGCTAGAGGTGCTCACTTACTCTGCTACCCTGGGGCATTTAACATGACAACTAGACCATTACATTGGGAGTTATTGGCTACAGATAATCAGTTATATGTGGCTACCTGTTCATCTGCCCGGGATACTGGATCTGTTTCTCTTCTTTCTATTGTAGTCGCAACTCCAACCCATTCTCGTTCTTCTTTTCTTACCACAGTGCAAGTCTAG
Predicted protein sequences of Glyma20g02020
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma20g02020.2 sequence type=predicted peptide gene model=Glyma20g02020 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MSATSVNSERALAPPAIPLPPPPLSNFKIGLYQLSVSPDKDNNIAHARTAIQDDASKGAQLVLLPEIWNSPYSNDSFSVYAEDIDAGASPSTAMLSELSRILKITIVGCFILESYGGLLYNTCCVFGTDENLLAKDRKIHLFDIDIPGKITFIESKTLTVGETLTIVDTEVGRISIGICYDIRFPELAMIYVARGAHLLCYPGAFNMTTRPLHWELLATDNQLYVATCSSARDTGSVSLLSIVVATPTHSRSSFLTTVQV*
SoyBase
SoyBase transitions to NEW site on 10/1/2024
