Glyma20g01470 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma20g01470

Feature Type:	gene_model
Chromosome:	Gm20
Start:	1002861
stop:	1006434
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma20g01470

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G17790	AT	Annotation by Michelle Graham. TAIR10: purple acid phosphatase 17 \| chr3:6089779-6090988 FORWARD LENGTH=338	SoyBase	E_val: 1.00E-147	ISS
GO:0016036	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular response to phosphate starvation	SoyBase	N/A	ISS
GO:0019375	GO-bp	Annotation by Michelle Graham. GO Biological Process: galactolipid biosynthetic process	SoyBase	N/A	ISS
GO:0030643	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular phosphate ion homeostasis	SoyBase	N/A	ISS
GO:0042542	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to hydrogen peroxide	SoyBase	N/A	ISS
GO:0045892	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0009986	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cell surface	SoyBase	N/A	ISS
GO:0003993	GO-mf	Annotation by Michelle Graham. GO Molecular Function: acid phosphatase activity	SoyBase	N/A	ISS
GO:0004722	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine phosphatase activity	SoyBase	N/A	ISS
GO:0016787	GO-mf	Annotation by Michelle Graham. GO Molecular Function: hydrolase activity	SoyBase	N/A	ISS
GO:0016791	GO-mf	Annotation by Michelle Graham. GO Molecular Function: phosphatase activity	SoyBase	N/A	ISS
KOG2679	KOG	Purple (tartrate-resistant) acid phosphatase	JGI		ISS
PTHR10161	Panther	ACID PHOSPHATASE-RELATED	JGI		ISS
PF00149	PFAM	Calcineurin-like phosphoesterase	JGI		ISS
UniRef100_B9T6A8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Tartrate-resistant acid phosphatase type 5, putative n=1 Tax=Ricinus communis RepID=B9T6A8_RICCO	SoyBase	E_val: 2.33E-156	ISS
UniRef100_I1ND52	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1ND52_SOYBN	SoyBase	E_val: 0	ISS

Proteins Associated with Glyma20g01470

Locus	Gene Symbol	Protein Name
	PAP34	Purple acid phosphatase 34 gene
	PAP34	Purple acid phosphatase gene 34

Expression Patterns of Glyma20g01470

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma20g01470 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.20g011900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma20g01470

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma20g01470

Limit To All Plant Sequences

>Glyma20g01470.1   sequence type=CDS   gene model=Glyma20g01470   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCCCCATCATCTCCCCTTCATTCAGCAGCAATTTTATGCATATATTTTGTGCTACCCGCTTTTGCAGAGCTTCAGAGGTTCCAACATCAACCAAAACATGATGGATCCCTCAACTTTCTAGTCATTGGAGATTGGGGTAGAAAAGGGCATTATAATCAATCCCTTGTAGCCACACAGATGGGAAAGATGGGAGACAAACTTGATTTAGATTTTGTTGTATCAACTGGAGACAATTTCTACAATAGTGGGTTAAAAGGTGTAAATGATCCATTATTTCTGCAGTCATTTTCCAACATTTACACTGCTAAGAGCCTTAGGAAGCAATGGTACTCTGTTTTGGGAAACCATGACTATAGGGGTAATGCACTGGCACAGTTAAGTCCACTCTTGAGGAAGATTGACAGGAGATGGTTTTGCCAGAGATCATTTATTCTTAATGCAGGAGTTGCTGAATTTTTCTTCATAGACACAACCCCGTTTATGAGAAAATATTTCAACAATTCGAATCGTCACTATGATTGGCGAGGCGTGCTTCCGAGGCAAAAATACCTCAAAACCCTTCTGAAGGATCTTGAGGAAGAATTGAGGAAATCAACTGCAAGATGGAAAATCGCTGTGGGTCACCATGCAATAAGAAGTATTGGCCATCACGGTGATAGTCCAGAACTTGTAAAGCACCTTGTCCCAGTACTTAAGGCCAACAATGTTGACATGTACATAAATGGGCATGACCATTGCCTCCAACATATAAGCAGCACAGATAGCCCACTTCTATATTTAACGAGTGGAGCAGGATCAAAGGCATGGAGAGGTGATGTTAAAGAAACCCACTTTGATGTGAAATTCTTTTATGATGGTCAAGGTTTCATGTCTGTTCAAATGACTGAAAATGACACAAATTTTGCTTTCTACAATGTCTTTGGTGAGAAGATACACCATTGGAAAGTGACTAAGTCCACGATGCATCCTTCTATATGA

Predicted protein sequences of Glyma20g01470

Limit To All Plant Sequences

>Glyma20g01470.1   sequence type=predicted peptide   gene model=Glyma20g01470   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASPSSPLHSAAILCIYFVLPAFAELQRFQHQPKHDGSLNFLVIGDWGRKGHYNQSLVATQMGKMGDKLDLDFVVSTGDNFYNSGLKGVNDPLFLQSFSNIYTAKSLRKQWYSVLGNHDYRGNALAQLSPLLRKIDRRWFCQRSFILNAGVAEFFFIDTTPFMRKYFNNSNRHYDWRGVLPRQKYLKTLLKDLEEELRKSTARWKIAVGHHAIRSIGHHGDSPELVKHLVPVLKANNVDMYINGHDHCLQHISSTDSPLLYLTSGAGSKAWRGDVKETHFDVKFFYDGQGFMSVQMTENDTNFAFYNVFGEKIHHWKVTKSTMHPSI*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain