Glyma20g00820 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma20g00820

Feature Type:	gene_model
Chromosome:	Gm20
Start:	536289
stop:	540998
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma20g00820

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G66654	AT	Annotation by Michelle Graham. TAIR10: Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein \| chr3:2088694-2090297 FORWARD LENGTH=236	SoyBase	E_val: 5.00E-91	ISS
GO:0006457	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein folding	SoyBase	N/A	ISS
GO:0005768	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: endosome	SoyBase	N/A	ISS
GO:0005794	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus	SoyBase	N/A	ISS
GO:0005802	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: trans-Golgi network	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0003755	GO-mf	Annotation by Michelle Graham. GO Molecular Function: peptidyl-prolyl cis-trans isomerase activity	SoyBase	N/A	ISS
KOG0881	KOG	Cyclophilin type peptidyl-prolyl cis-trans isomerase	JGI		ISS
PTHR11071	Panther	CYCLOPHILIN	JGI		ISS
PTHR11071:SF20	Panther	gb def: similarity to copii-coated vesicle proteins [schizosaccharomyces pombe]	JGI		ISS
PF00160	PFAM	Cyclophilin type peptidyl-prolyl cis-trans isomerase/CLD	JGI		ISS
UniRef100_I3XK00	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Cyclophilin-like peptidyl-prolyl cis-trans isomerase n=1 Tax=Cirsium arvense RepID=I3XK00_CIRAR	SoyBase	E_val: 1.00E-98	ISS
UniRef100_UPI000233D95E	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233D95E related cluster n=1 Tax=unknown RepID=UPI000233D95E	SoyBase	E_val: 3.00E-168	ISS

Expression Patterns of Glyma20g00820

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma20g00820

Paralog	Evidence	Comments
Glyma07g19441	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma20g00820 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.20g005600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma20g00820

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma20g00820

Limit To All Plant Sequences

>Glyma20g00820.1   sequence type=CDS   gene model=Glyma20g00820   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGGAGGATCAAGCCTCAGGCTCTGCTACAGCAAAGCAAAAGGAAGAAGGGGCCTTCTCGCATAAGTGCCACCATTGTTACATTCTATGCATTGATTCTTGTCATGCTTGTGTTTATCCTGTTTGTTACATACAGACATTGGTCCAACAGGACAAGACTTCAACCAGAGAGCTACATATCAGTCTCTGAGGATGAAAATACATCTGTGGAATCCAAAAAATCTGATCTACCTGGATATGCTGTTGTAATTACCTCTAAAGGTTCTATTATAGTAGAACTTTACAAGGAAAGTGCTCCTGAAGTTGTTGATGAATTCATAGATTTATGTCAAAAAGGGCACTTCAAGGGGATGCTTTTTCACCAAGTAATTAAACACTATATAATTCAGGCAGGTCATAACAAAGGGCCTGGAGCTACTGAAGATTGGAACCTGTTAGGAAAGAAATACGCAAGTATGAGACACGAAGCATTCATGCTCGGAACATCGAAGGGAAAATACTTTAACAAAGGATTTGATCTTTTCATCACAACTGCACCAATACCAGATTTAAATGAAAAGCTTATTGTGTTTGGCCGAGTCATCAAGGGACAGGATATTGTTCAGGAAATTGAAGAAGTGGATACAGATGAACATTACCAACCAAAACTTACTATTGGGATACTTGATGTGGCTCTTAAACAGATAGTGTGA

Predicted protein sequences of Glyma20g00820

Limit To All Plant Sequences

>Glyma20g00820.1   sequence type=predicted peptide   gene model=Glyma20g00820   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGRIKPQALLQQSKRKKGPSRISATIVTFYALILVMLVFILFVTYRHWSNRTRLQPESYISVSEDENTSVESKKSDLPGYAVVITSKGSIIVELYKESAPEVVDEFIDLCQKGHFKGMLFHQVIKHYIIQAGHNKGPGATEDWNLLGKKYASMRHEAFMLGTSKGKYFNKGFDLFITTAPIPDLNEKLIVFGRVIKGQDIVQEIEEVDTDEHYQPKLTIGILDVALKQIV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain