Glyma19g44660 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g44660

Feature Type:	gene_model
Chromosome:	Gm19
Start:	50015325
stop:	50017940
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g44660

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G13540	AT	Annotation by Michelle Graham. TAIR10: myb domain protein 5 \| chr3:4420239-4421443 FORWARD LENGTH=249	SoyBase	E_val: 1.00E-66	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0009845	GO-bp	Annotation by Michelle Graham. GO Biological Process: seed germination	SoyBase	N/A	ISS
GO:0010026	GO-bp	Annotation by Michelle Graham. GO Biological Process: trichome differentiation	SoyBase	N/A	ISS
GO:0010090	GO-bp	Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis	SoyBase	N/A	ISS
GO:0010214	GO-bp	Annotation by Michelle Graham. GO Biological Process: seed coat development	SoyBase	N/A	ISS
GO:0010468	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of gene expression	SoyBase	N/A	ISS
GO:0048354	GO-bp	Annotation by Michelle Graham. GO Biological Process: mucilage biosynthetic process involved in seed coat development	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
KOG0048	KOG	Transcription factor, Myb superfamily	JGI		ISS
PTHR10641	Panther	MYB-RELATED	JGI		ISS
PF00249	PFAM	Myb-like DNA-binding domain	JGI		ISS
UniRef100_Q0PJK2	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: MYB transcription factor MYB185 n=1 Tax=Glycine max RepID=Q0PJK2_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_Q0PJK2	UniRef	Annotation by Michelle Graham. Best UniRef hit: MYB transcription factor MYB185 n=1 Tax=Glycine max RepID=Q0PJK2_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma19g44660

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g44660

Paralog	Evidence	Comments
Glyma03g41965	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g44660 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g257400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g44660

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g44660

Limit To All Plant Sequences

>Glyma19g44660.1   sequence type=CDS   gene model=Glyma19g44660   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAAGAGCTCCTTGTTGCTCTAAAGTAGGGTTGCATAGAGGTCCATGGACTCCTCGAGAAGATGCATTGCTCACTAAGTATATTCAAACTCATGGAGAAGGCCAGTGGAGATCACTACCAAAAAGAGCCGGGCTTCTTAGATGCGGAAAAAGTTGCCGACTGAGATGGATGAACTATCTGAGACCAGATATAAAGAGAGGAAACATAACCCCAGAAGAAGATGATCTTATAGTTAGAATGCATTCGCTTTTAGGAAATAGATGGTCCCTCATCGCGGGGAGATTACCAGGACGAACAGATAATGAGATTAAGAACTACTGGAATACCCATCTCAGCAAGAAGCTGAGAAATCAAGGAACCGATCCAAAGACACACGACAAGTTAACTGAGGCACCAGAGAAGAAGAAGGGTAAAAAGAAGAATAAGCAAAAGAATGAGAATAACAAAGGGTCAGAGAAGACTTTAGTTTATCTACCAAAACCCATAAGGGTTAAGGCTTTATCATCATGTATACCCAGAACGGATAGCACCTTAACCCTTAATTCCAATTCAGCAACTGCATCAACTAGCGAAGAGAAAGTTCAAAGCCCAGAAGCAGAAGTAAAAGAGGTGAACATGGTTTGGGGGGTAGGTGACGATGCAGACAATGGTGGGATTGAAATATTCTTTGGTGAAGACCATGACCTAGTCAACAATACTGCCTCTTACGAGGAATGCTATTCTGATGTTCACACTGATGATCATGGTACGCTAGAAAAACTCTACGAAGAGTACTTGCAGCTCTTGAATGTTGAGGAGAAGCCAGATGAATTAGATTCTTTTGCTCAATCTTTATTGGTGTAA

Predicted protein sequences of Glyma19g44660

Limit To All Plant Sequences

>Glyma19g44660.1   sequence type=predicted peptide   gene model=Glyma19g44660   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGRAPCCSKVGLHRGPWTPREDALLTKYIQTHGEGQWRSLPKRAGLLRCGKSCRLRWMNYLRPDIKRGNITPEEDDLIVRMHSLLGNRWSLIAGRLPGRTDNEIKNYWNTHLSKKLRNQGTDPKTHDKLTEAPEKKKGKKKNKQKNENNKGSEKTLVYLPKPIRVKALSSCIPRTDSTLTLNSNSATASTSEEKVQSPEAEVKEVNMVWGVGDDADNGGIEIFFGEDHDLVNNTASYEECYSDVHTDDHGTLEKLYEEYLQLLNVEEKPDELDSFAQSLLV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain