SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g44510

Feature Type:gene_model
Chromosome:Gm19
Start:49905179
stop:49907115
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma19g44510
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G46500AT Annotation by Michelle Graham. TAIR10: phosphoinositide 4-kinase gamma 4 | chr2:19086741-19088534 REVERSE LENGTH=566 SoyBaseE_val: 0ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0002679GO-bp Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response SoyBaseN/AISS
GO:0006499GO-bp Annotation by Michelle Graham. GO Biological Process: N-terminal protein myristoylation SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0007154GO-bp Annotation by Michelle Graham. GO Biological Process: cell communication SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009738GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0030968GO-bp Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0035556GO-bp Annotation by Michelle Graham. GO Biological Process: intracellular signal transduction SoyBaseN/AISS
GO:0042538GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response SoyBaseN/AISS
GO:0043069GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death SoyBaseN/AISS
GO:0046854GO-bp Annotation by Michelle Graham. GO Biological Process: phosphatidylinositol phosphorylation SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0004430GO-mf Annotation by Michelle Graham. GO Molecular Function: 1-phosphatidylinositol 4-kinase activity SoyBaseN/AISS
GO:0016773GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphotransferase activity, alcohol group as acceptor SoyBaseN/AISS
KOG2381 KOG Phosphatidylinositol 4-kinase JGI ISS
PTHR15245Panther FAMILY NOT NAMED JGI ISS
PTHR15245:SF11Panther gb def: T17H3.7 JGI ISS
PF00240PFAM Ubiquitin family JGI ISS
PF00454PFAM Phosphatidylinositol 3- and 4-kinase JGI ISS
UniRef100_G8A2Y5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ubiquitin n=1 Tax=Medicago truncatula RepID=G8A2Y5_MEDTR SoyBaseE_val: 0ISS
UniRef100_UPI00023379B8UniRef Annotation by Michelle Graham. Best UniRef hit: UPI00023379B8 related cluster n=1 Tax=unknown RepID=UPI00023379B8 SoyBaseE_val: 0ISS

Expression Patterns of Glyma19g44510
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g44510
ParalogEvidenceComments
Glyma03g41850 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g44510 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g256100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma19g44510
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma19g44510
>Glyma19g44510.1   sequence type=CDS   gene model=Glyma19g44510   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCATCTGCCGGTGTCTCTACTCTTAGTGTGGTTCCCACTGAGCCATTGCTCTCACCAATGGCATTCCCTTTTCCAATTCCATCACACTTGTCTTTGGAAGATAAATCCATTTTCATATACCTCTCCTTTTCTGGCTCATTGACTCCCATCCGTGTTATGGAGTGGGATACCATTGAATCTGTCAAATTCAAAATCCAAAGGTCTGAAAGCCTTCCGTTTTTAACAAACAAGCAGAAGTTGGTTTATGCTGGCCGAGAGCTTGCGCGAAGTGATTCGCTGCTCAAGGACTATGGAGTAACCGATGGAAATGTTTTGCATTTGATAATCAAACTGTCAGATCTTCAGGTCATCAGTGTGAAAACTTCTTGTGGGAAGGAATTCACGTTTCAGGTCGAACGAGGCAGGGATGTCGGGTACATAAAGCGGCGGATTGCCAGAAGGGAGAAACAGTTTGATGATCCTGAGGAGCAGGAGCTTGTGTGCAATGGGGAAAGGCTTGAGGACCAGAGGCTTATTGATGAAATATGCTGCAAACATAATGATGCAGTGGTACATCTGTTTGTGAGAAAAAAACATGTTAAAGTTCAGAGGAGGCCCCTTGAGTTGTCCATTGTAGCAAAAGATTTGATTAATAAGAAAAAAAATGATGTCAATGGAAATACTAACAGGAGAAGTTATGATGTTGGTAAAGAAGATACTATTAGGAAGTCTGATGTCATTCAAAGAGCTGTGCCGAGGAAGCCTCCCGATAGAGATTTTATTTTGGAGCCAGTTATTATTAACCCTAAAATTGAATTAGCTCCAGCTATTTGGAATATGGTGAACTCTACATATGATGGACTTGGCAGTGGCAAATATCCAATCAGATCTGCAGAGGGTACAGGAGGGGCTTACTTTATGATTGATTCAGCGGGGCAAAAGCCAATGGCTCTGAATAACCCTCGAGGTCTTCCTTTGTCATTAGATGGCGAAGGCTTAAAAAAGGGTACAAGAGTTGGTCAAGGAGCATTCAGGGAAGTTGCAGCCTATGTTCTAGACCATCCATTGAGTGGGCGCCGCTCGTTATTTGGTGATGGGAAGGGCTTTGCTGGTGTTCCCCCAACATTGATGGTTAAGTGCTTGCATAAATCATTCAACTATCCCAGAGAATTTACTCCTAAGATTGGCTCCTTGCAAATGTTCACAGAAAATAGTGGAAGTTGTGAAGATATGGGCCCGGGGGCTTTCCCAGTAAAGGAGGTACATAAAATTACTGTTTTGGACATAAGACTGGCTAATGCAGATAGGCATGCTGGGAATATTTTGATCAGCAAAGAGGAGGACAACAACCAGTCTGTTCTGATTCCAATTGATCATGGATACTGCCTGCCCACAAGCTTTGAAGATTGTACCTTTGAGTGGCTTTACTGGCCTCAAGCTCGCCAGCCATACTCCCCAGAAACTATTGACTACATAAAGTCACTGGATGCTGAAGAAGATATTGCCCTTTTAAAGTTTCATGGATGGGATCTGCCAGTTGAATGTGCCCGCACTCTTAGGATCTCAACCATGCTTTTGAAGAAAGGGGTAGAGAGAGGATTGACCCCTTTTGCCATTGGAAACCTGATGTGCAGAGAATCCTTGAACAAGGAATCTGTGATTGAAGAAATAGTACAAGCAGCACTGGATTCTGTTCTTCCTGGCACAAGTGAAGCTACATTGCTGGATGCTGTTTCCCAAATCATGGACTTGCGCCTCGATGAGATTGTCAGAGCTCGTTTATAA
Predicted protein sequences of Glyma19g44510
>Glyma19g44510.1   sequence type=predicted peptide   gene model=Glyma19g44510   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSSAGVSTLSVVPTEPLLSPMAFPFPIPSHLSLEDKSIFIYLSFSGSLTPIRVMEWDTIESVKFKIQRSESLPFLTNKQKLVYAGRELARSDSLLKDYGVTDGNVLHLIIKLSDLQVISVKTSCGKEFTFQVERGRDVGYIKRRIARREKQFDDPEEQELVCNGERLEDQRLIDEICCKHNDAVVHLFVRKKHVKVQRRPLELSIVAKDLINKKKNDVNGNTNRRSYDVGKEDTIRKSDVIQRAVPRKPPDRDFILEPVIINPKIELAPAIWNMVNSTYDGLGSGKYPIRSAEGTGGAYFMIDSAGQKPMALNNPRGLPLSLDGEGLKKGTRVGQGAFREVAAYVLDHPLSGRRSLFGDGKGFAGVPPTLMVKCLHKSFNYPREFTPKIGSLQMFTENSGSCEDMGPGAFPVKEVHKITVLDIRLANADRHAGNILISKEEDNNQSVLIPIDHGYCLPTSFEDCTFEWLYWPQARQPYSPETIDYIKSLDAEEDIALLKFHGWDLPVECARTLRISTMLLKKGVERGLTPFAIGNLMCRESLNKESVIEEIVQAALDSVLPGTSEATLLDAVSQIMDLRLDEIVRARL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo