SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g44401

Feature Type:gene_model
Chromosome:Gm19
Start:49846690
stop:49847847
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma19g44401
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G01040AT Annotation by Michelle Graham. TAIR10: Glycosyl hydrolase superfamily protein | chr4:453383-455407 FORWARD LENGTH=430 SoyBaseE_val: 5.00E-66ISS
GO:0005975GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process SoyBaseN/AISS
GO:0005783GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004553GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, hydrolyzing O-glycosyl compounds SoyBaseN/AISS
GO:0004568GO-mf Annotation by Michelle Graham. GO Molecular Function: chitinase activity SoyBaseN/AISS
GO:0043169GO-mf Annotation by Michelle Graham. GO Molecular Function: cation binding SoyBaseN/AISS
PTHR11177Panther CHITINASE JGI ISS
PTHR11177:SF6Panther CHITINASE-RELATED JGI ISS
PF00704PFAM Glycosyl hydrolases family 18 JGI ISS
UniRef100_G7K407UniRef Annotation by Michelle Graham. Most informative UniRef hit: Chitinase domain-containing protein n=1 Tax=Medicago truncatula RepID=G7K407_MEDTR SoyBaseE_val: 8.00E-84ISS
UniRef100_UPI000233ED08UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233ED08 related cluster n=1 Tax=unknown RepID=UPI000233ED08 SoyBaseE_val: 7.00E-98ISS

Expression Patterns of Glyma19g44401
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g44401 not represented in the dataset
Glyma19g44401 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g44401
ParalogEvidenceComments
Glyma03g41760 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g44401 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g255000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma19g44401
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma19g44401
>Glyma19g44401.1   sequence type=CDS   gene model=Glyma19g44401   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCTTACAATTCTTTCTCGCTCAATGCTCGCAACTACGAGTGACTACAAACCAAAGTTATTTTTTGTCGATATTTTTTTGCTCAGAAAATTTTTCTCGTTAATGACATATGACTTCTCTAATCCTCATAATCCTGGTCCTAATGCACCTATGAAATGGATTCAAATTGTTCTACAGCTGCTTCTTGGTACCTCTGCCAATAGAACCCAAAGCCTTGCCCCCAAGATACTTCTCGGCATCGACTTCTATGGAAATGATTTCTCCCTTTCAAGGGATGCAGGTGGTGGAGCTATTATTGGGAGAGATTACCTGGCACTTTTGGAGAAGCACAGGCCTGAACTGCAGTGGGATAAGAATAGTGGGGAGCATTTTTTCTTTTACACTGACAACAAGGATATCAGGCATGCGGTATTCTATCCATCTTCGAAGTCAATTTCTTTGCGGTCAGAGGAAGCTCGTTCACGGGGGTGTGGCATCTCGATCTGGGAAATTGGCCAAGGCTTGGATTATTTTTTTTACCTTCTTTGA
Predicted protein sequences of Glyma19g44401
>Glyma19g44401.1   sequence type=predicted peptide   gene model=Glyma19g44401   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLTILSRSMLATTSDYKPKLFFVDIFLLRKFFSLMTYDFSNPHNPGPNAPMKWIQIVLQLLLGTSANRTQSLAPKILLGIDFYGNDFSLSRDAGGGAIIGRDYLALLEKHRPELQWDKNSGEHFFFYTDNKDIRHAVFYPSSKSISLRSEEARSRGCGISIWEIGQGLDYFFYLL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo