Glyma19g44380 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g44380

Feature Type:	gene_model
Chromosome:	Gm19
Start:	49828036
stop:	49830844
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g44380

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G11070	AT	Annotation by Michelle Graham. TAIR10: WRKY family transcription factor \| chr4:6759303-6760763 FORWARD LENGTH=313	SoyBase	E_val: 1.00E-48	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0043565	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding	SoyBase	N/A	ISS
PF03106	PFAM	WRKY DNA -binding domain	JGI		ISS
UniRef100_A7LHI0	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: WRKY43 (Fragment) n=1 Tax=Glycine max RepID=A7LHI0_SOYBN	SoyBase	E_val: 5.00E-171	ISS
UniRef100_I1NCK2	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NCK2_SOYBN	SoyBase	E_val: 0	ISS

Proteins Associated with Glyma19g44380

Locus	Gene Symbol	Protein Name
	WRKY179	WRKY Transcription Factor

Expression Patterns of Glyma19g44380

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g44380

Paralog	Evidence	Comments
Glyma03g41750	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g44380 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g254800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g44380

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g44380

Limit To All Plant Sequences

>Glyma19g44380.1   sequence type=CDS   gene model=Glyma19g44380   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAGAGAGCACCAAGAGGAAACACACTAGTCTGATCCATGAACTAATCCAAGGAAAGGAACTAACAAAGCAGCTTAGTAACCACCTGGTTTCATCTTCTCCAATGTCCCATCAAACCAATGAATTGTTTGTTGAGAAAATACTTTTGTCTTATGAGAAAGCACTCACCATGCTGAACTGGGGCTCTATTATGGGAGAGGCCAAGACCACCAGTGGCAACATCATGGATTCCCATTGTTCTTTTACAAATGGTGGGAGCCCCAGAAGTGAGGTCGTGGACCGTGAATTGGAGCACAAAGCTGCCCTCAAGAAAAGAAAGACCATGCCCAGATGGACCGAGCAAGTGAAGATTTGCTCAAGAAGAGGACTTGAAGGGTCATTGGATGATGGATATAGCTGGAGAAAATATGGCCAAAAGGATATTCTCAGAGCTAAGTTTCCAAGAGGATATTACAGATGCACACATAGAAATGTACAAGGGTGTCTAGCAACAAAACAAGTTCAAAGGTCAGATGAAGACCCAACAACAATTGAGGTGACCTACAGAGGAAGACATACATGCACGCAAGCTAAGCATTTAAACAAGGCATTCCCATCAAACATCAAGGCATGTTTGGGAGAAAATCAATTTCAAAAGAATCAACCACTTCTAGAGAAAATACAACAACAAACCCCTGAGGTGATTTTCACCTTTGAAACAGAGCTTAAAGTCAAAACAGAGGAATTGGAAACCAAGGAGGATATCTTCCCATGGTTTTCCTTTCCTTCTCCATCAATTGGATCAGAAAACGAGGACAACATGTTACCCGAGACTATGTTTGAAAACCATTTCATGGAAAGCTTCTCTCCAGTATTCTTATCACCAGCGACTTCAGAATCAAACCCTTTCTGTTTGTCAGCGTACCACTTGGACAGCACTGGACTATTATGCCAAAACATACAAACCTCAGAATCTGATATCACTGAGATAGTTTCAGCCCCAACTTCAGTCACCAAGTCCCCAATCCTGGATTTGGATATCTTGCTTGATAAAGGGGATTTTGACACGGATTTCCCTTTCAACATTCCTGAATTTTTCTCTTCATAA

Predicted protein sequences of Glyma19g44380

Limit To All Plant Sequences

>Glyma19g44380.1   sequence type=predicted peptide   gene model=Glyma19g44380   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEESTKRKHTSLIHELIQGKELTKQLSNHLVSSSPMSHQTNELFVEKILLSYEKALTMLNWGSIMGEAKTTSGNIMDSHCSFTNGGSPRSEVVDRELEHKAALKKRKTMPRWTEQVKICSRRGLEGSLDDGYSWRKYGQKDILRAKFPRGYYRCTHRNVQGCLATKQVQRSDEDPTTIEVTYRGRHTCTQAKHLNKAFPSNIKACLGENQFQKNQPLLEKIQQQTPEVIFTFETELKVKTEELETKEDIFPWFSFPSPSIGSENEDNMLPETMFENHFMESFSPVFLSPATSESNPFCLSAYHLDSTGLLCQNIQTSESDITEIVSAPTSVTKSPILDLDILLDKGDFDTDFPFNIPEFFSS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain