Report for Sequence Feature Glyma19g44350
Feature Type: gene_model
Chromosome: Gm19
Start: 49809604
stop: 49811330
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma19g44350
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT4G01070 AT
Annotation by Michelle Graham. TAIR10: UDP-Glycosyltransferase superfamily protein | chr4:461858-463300 REVERSE LENGTH=480
SoyBase E_val: 0 ISS
GO:0006612 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane
SoyBase N/A ISS
GO:0006805 GO-bp
Annotation by Michelle Graham. GO Biological Process: xenobiotic metabolic process
SoyBase N/A ISS
GO:0008152 GO-bp
Annotation by Michelle Graham. GO Biological Process: metabolic process
SoyBase N/A ISS
GO:0009611 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to wounding
SoyBase N/A ISS
GO:0009636 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to toxin
SoyBase N/A ISS
GO:0009651 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to salt stress
SoyBase N/A ISS
GO:0009805 GO-bp
Annotation by Michelle Graham. GO Biological Process: coumarin biosynthetic process
SoyBase N/A ISS
GO:0009963 GO-bp
Annotation by Michelle Graham. GO Biological Process: positive regulation of flavonoid biosynthetic process
SoyBase N/A ISS
GO:0010363 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response
SoyBase N/A ISS
GO:0042178 GO-bp
Annotation by Michelle Graham. GO Biological Process: xenobiotic catabolic process
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0008194 GO-mf
Annotation by Michelle Graham. GO Molecular Function: UDP-glycosyltransferase activity
SoyBase N/A ISS
GO:0016757 GO-mf
Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring glycosyl groups
SoyBase N/A ISS
GO:0016758 GO-mf
Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring hexosyl groups
SoyBase N/A ISS
GO:0035251 GO-mf
Annotation by Michelle Graham. GO Molecular Function: UDP-glucosyltransferase activity
SoyBase N/A ISS
KOG1192
KOG
UDP-glucuronosyl and UDP-glucosyl transferase
JGI ISS
PTHR11926 Panther
GLUCOSYL/GLUCURONOSYL TRANSFERASES
JGI ISS
PTHR11926:SF15 Panther
UDP-GLUCURONOSYLTRANSFERASE RELATED
JGI ISS
PF00201 PFAM
UDP-glucoronosyl and UDP-glucosyl transferase
JGI ISS
UniRef100_A5I866 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Glucosyltransferase n=1 Tax=Glycine max RepID=A5I866_SOYBN
SoyBase E_val: 0 ISS
UniRef100_I1NCJ3 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1NCJ3_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma19g44350
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma19g44350
Paralog Evidence Comments
Glyma03g41730 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma19g44350 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.19g254500 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma19g44350
Coding sequences of Glyma19g44350
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma19g44350.1 sequence type=CDS gene model=Glyma19g44350 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGAAGAAGAAGCTCCTCCAGTGCCACCTGCACCGCCCATAGTGGCCATGCTGCCATCCCCTGGCATGGGCCACCTAATCCCAATGATCGAGTTCGCCAAGCGAGCGGTGCGCTACCATAACCTGGCCGTCACCTTCGTCATCCCCACTGACGGCCCACCTTCTAAAGCCCAAAAGGCCGTCTTCCAGGCCCTCCCGGACTCCATTTCCCACACCTTCCTCCCTCCGGTCAATCTCTCCGACTTTCCACCGGGCACCAAAATTGAAACCCTGATCTCCCACACCGTCCTCCTCTCCCTCCCTTCCCTCCGCCAAGCCTTCCACTCCCTCTCCTCCACATACACCCTCGCCGCCGTCGTCGTCGACCTCTTCGCCACCGACGCCTTCGACGTCGCCGCCGAATTCAATGCCTCCCCCTACGTCTTCTACCCCTCCACAGCCACCGTCCTCTCCATCGCCCTCCACCTCCCCACCCTCGACAAGCAGGTCCAGTGCGAGTTCCGAGACCTCCCGGAACCGGTCACCATCCCCGGTTGCATTCCTCTTCCCGTCAAGGACTTTCTAGACCCGGTTCTGGAGCGCACCAACGAGGCCTACAAGTGGGTCCTACACCACTCCAAGCGCTACCGAGAAGCCGAGGGAATCATCGAGAACAGCTTCGCCGAACTCGAACCGGGCGCCTGGAACGAGCTGCAGAGGGAACAACCGGGACGGCCTCCGGTTTATGCGGTCGGGCCGCTTGTGAGAATGGAACCCGGTCCCGCCGACTCCGAGTGCTTGAGGTGGTTGGACGAGCAGCCACGTGGCAGCGTGTTGTTTGTTTCCTTCGGAAGCGGTGGGACCCTCTCCAGCGCCCAGATCAACGAACTGGCTCTCGGGTTGGAAAATAGCCAGCAACGGTTCTTGTGGGTGGTGAAGAGCCCAAACGATGCAATAGCCAACGCGACTTACTTCAACGCGGAGAGCCACGAGGATCCCTTGCAGTTCTTACCAGAAGGGTTCGTGGAGAGAACAAAAGGAAGGGGCTTTTTGGTTAAGTCATGGGCTCCGCAGCCACAGGTTCTGGCCCATCAATCAACGGGAGGATTCTTGAGCCATTGCGGCTGGAACTCTATACTGGAGAGCGTGGTGAACGGCGTGCCTTTAATAGCCTGGCCTCTGTTCGCGGAGCAGAGGACCAACGCGTTTATGCTCATGCATGAAGTCAAGGTGGCGCTGAGGCCCAAAGTTGCCGAGGACACTGGACTTGTCCAGAGCCAGGAAATAGCCAGCGTTGTCAAGTGCCTCATGGAAGGCCATGAAGGGAAGAAGCTTCGTTACCGAATCAAGGATCTCAAGGAGGCTGCGGCTAAGGCTCTCTCTCCAAATGGTTCCTCCACCGACCATATCTCCAATTTGGTTCTCAAGTGGACCAACAAAACCACCATCTCTACTAGTGGCTAG
Predicted protein sequences of Glyma19g44350
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma19g44350.1 sequence type=predicted peptide gene model=Glyma19g44350 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MEEEAPPVPPAPPIVAMLPSPGMGHLIPMIEFAKRAVRYHNLAVTFVIPTDGPPSKAQKAVFQALPDSISHTFLPPVNLSDFPPGTKIETLISHTVLLSLPSLRQAFHSLSSTYTLAAVVVDLFATDAFDVAAEFNASPYVFYPSTATVLSIALHLPTLDKQVQCEFRDLPEPVTIPGCIPLPVKDFLDPVLERTNEAYKWVLHHSKRYREAEGIIENSFAELEPGAWNELQREQPGRPPVYAVGPLVRMEPGPADSECLRWLDEQPRGSVLFVSFGSGGTLSSAQINELALGLENSQQRFLWVVKSPNDAIANATYFNAESHEDPLQFLPEGFVERTKGRGFLVKSWAPQPQVLAHQSTGGFLSHCGWNSILESVVNGVPLIAWPLFAEQRTNAFMLMHEVKVALRPKVAEDTGLVQSQEIASVVKCLMEGHEGKKLRYRIKDLKEAAAKALSPNGSSTDHISNLVLKWTNKTTISTSG*