Glyma19g44300 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma19g44300): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma19g44300): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma19g44300

Feature Type:	gene_model
Chromosome:	Gm19
Start:	49758712
stop:	49764068
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g44300

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G01100	AT	Annotation by Michelle Graham. TAIR10: adenine nucleotide transporter 1 \| chr4:477411-479590 FORWARD LENGTH=352	SoyBase	E_val: 0	ISS
GO:0006007	GO-bp	Annotation by Michelle Graham. GO Biological Process: glucose catabolic process	SoyBase	N/A	ISS
GO:0006096	GO-bp	Annotation by Michelle Graham. GO Biological Process: glycolysis	SoyBase	N/A	ISS
GO:0006098	GO-bp	Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt	SoyBase	N/A	ISS
GO:0006810	GO-bp	Annotation by Michelle Graham. GO Biological Process: transport	SoyBase	N/A	ISS
GO:0006839	GO-bp	Annotation by Michelle Graham. GO Biological Process: mitochondrial transport	SoyBase	N/A	ISS
GO:0009060	GO-bp	Annotation by Michelle Graham. GO Biological Process: aerobic respiration	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0015866	GO-bp	Annotation by Michelle Graham. GO Biological Process: ADP transport	SoyBase	N/A	ISS
GO:0015867	GO-bp	Annotation by Michelle Graham. GO Biological Process: ATP transport	SoyBase	N/A	ISS
GO:0046686	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cadmium ion	SoyBase	N/A	ISS
GO:0055085	GO-bp	Annotation by Michelle Graham. GO Biological Process: transmembrane transport	SoyBase	N/A	ISS
GO:0080121	GO-bp	Annotation by Michelle Graham. GO Biological Process: AMP transport	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0005743	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial inner membrane	SoyBase	N/A	ISS
GO:0005774	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane	SoyBase	N/A	ISS
GO:0009536	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plastid	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0005347	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP transmembrane transporter activity	SoyBase	N/A	ISS
GO:0015217	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ADP transmembrane transporter activity	SoyBase	N/A	ISS
GO:0080122	GO-mf	Annotation by Michelle Graham. GO Molecular Function: AMP transmembrane transporter activity	SoyBase	N/A	ISS
KOG0752	KOG	Mitochondrial solute carrier protein	JGI		ISS
PTHR24089	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR24089:SF87	Panther	SUBFAMILY NOT NAMED	JGI		ISS
PF00153	PFAM	Mitochondrial carrier protein	JGI		ISS
UniRef100_B9T344	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Grave disease carrier protein, putative n=1 Tax=Ricinus communis RepID=B9T344_RICCO	SoyBase	E_val: 0	ISS
UniRef100_I1NCI8	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NCI8_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma19g44300

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g44300 not represented in the dataset	Glyma19g44300 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g44300

Paralog	Evidence	Comments
Glyma03g41690	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g44300 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g253900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g44300

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g44300

Limit To All Plant Sequences

>Glyma19g44300.1   sequence type=CDS   gene model=Glyma19g44300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCGGAGACGAAGGTCGTGAATCTGGCTGAGGAAGCCAAGCTCGCCAGAGAAGGTGTCACGGCTCCCTCCTATGCTTTTACCACCATCTGCAAGTCCCTCGTCGCTGGTGGAGTCGCCGGAGGAGTATCACGAACTGCAGTTGCTCCACTGGAACGGTTGAAGATTTTGCTACAGGTTCAGAATCCCCACAGCATTAAATACAATGGAACAATTCAAGGTCTAAAATATATATGGAGAACTGAAGGTTTTCGTGGGCTGTTCAAAGGGAATGGTACTAATTGTGCTCGAATTGTCCCAAATTCTGCTGTGAAGTTCTTCAGTTATGAGCAAGCTTCCAAAGGTATACTACATCTGTATCAGAAGCAAACTGGAAACGAGGATGCTCAGCTGACTCCTCTTTTCCGTCTTGGGGCTGGAGCATGTGCGGGAATAATTGCCATGTCTGCAACTTATCCAATGGACATGGTTCGAGGCAGAATAACTGTACAGACAGAGAAGTCCCCTTACCAGTACAGAGGAATGTTTCATGCTCTGTCAACTGTACTCAGGGAAGAAGGTCCACGTGCTTTATATAAGGGGTGGCTTCCTTCAGTCATTGGAGTTATTCCTTATGTGGGCCTCAACTTTGCTGTGTACGAGTCTTTGAAAGATTGGTTAGTTAAATCTAATCCATTAGGTCTAGTTCAAGATTCCGAGTTGAGTGTGACAACTCGCCTGGCTTGTGGTGCTGCAGCTGGAACTATTGGACAAACTGTTGCTTACCCTCTTGATGTCATTCGTCGAAGAATGCAGATGGTGGGTTGGAACCATGCTGCTTCTGTTGTAGCTGGTGATGGAAGAGGGAAGGTACCTCTTGCATACACTGGCATGGTTGATGCTTTTAGGAAAACTGTTCGGTATGAGGGATTTGGCGCATTATACAGGGGTCTGGTGCCAAATTCTGTAAAGGTGGTCCCATCCATAGCAATTGCGTTTGTAACATATGAGGTGGTGAAGGACATTTTAGGAGTGGAGATCAGGATATCAGACTGA

Predicted protein sequences of Glyma19g44300

Limit To All Plant Sequences

>Glyma19g44300.1   sequence type=predicted peptide   gene model=Glyma19g44300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASETKVVNLAEEAKLAREGVTAPSYAFTTICKSLVAGGVAGGVSRTAVAPLERLKILLQVQNPHSIKYNGTIQGLKYIWRTEGFRGLFKGNGTNCARIVPNSAVKFFSYEQASKGILHLYQKQTGNEDAQLTPLFRLGAGACAGIIAMSATYPMDMVRGRITVQTEKSPYQYRGMFHALSTVLREEGPRALYKGWLPSVIGVIPYVGLNFAVYESLKDWLVKSNPLGLVQDSELSVTTRLACGAAAGTIGQTVAYPLDVIRRRMQMVGWNHAASVVAGDGRGKVPLAYTGMVDAFRKTVRYEGFGALYRGLVPNSVKVVPSIAIAFVTYEVVKDILGVEIRISD*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain