SoyBase
SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research
SoyBase
SoyBase transitions to NEW site on 10/1/2024
|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT1G08550 | AT | Annotation by Michelle Graham. TAIR10: non-photochemical quenching 1 | chr1:2707462-2709387 FORWARD LENGTH=462 | SoyBase | E_val: 0 | ISS |
| GO:0000096 | GO-bp | Annotation by Michelle Graham. GO Biological Process: sulfur amino acid metabolic process | SoyBase | N/A | ISS |
| GO:0006098 | GO-bp | Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt | SoyBase | N/A | ISS |
| GO:0006364 | GO-bp | Annotation by Michelle Graham. GO Biological Process: rRNA processing | SoyBase | N/A | ISS |
| GO:0006546 | GO-bp | Annotation by Michelle Graham. GO Biological Process: glycine catabolic process | SoyBase | N/A | ISS |
| GO:0006631 | GO-bp | Annotation by Michelle Graham. GO Biological Process: fatty acid metabolic process | SoyBase | N/A | ISS |
| GO:0006636 | GO-bp | Annotation by Michelle Graham. GO Biological Process: unsaturated fatty acid biosynthetic process | SoyBase | N/A | ISS |
| GO:0006655 | GO-bp | Annotation by Michelle Graham. GO Biological Process: phosphatidylglycerol biosynthetic process | SoyBase | N/A | ISS |
| GO:0006733 | GO-bp | Annotation by Michelle Graham. GO Biological Process: oxidoreduction coenzyme metabolic process | SoyBase | N/A | ISS |
| GO:0006766 | GO-bp | Annotation by Michelle Graham. GO Biological Process: vitamin metabolic process | SoyBase | N/A | ISS |
| GO:0008652 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cellular amino acid biosynthetic process | SoyBase | N/A | ISS |
| GO:0009072 | GO-bp | Annotation by Michelle Graham. GO Biological Process: aromatic amino acid family metabolic process | SoyBase | N/A | ISS |
| GO:0009106 | GO-bp | Annotation by Michelle Graham. GO Biological Process: lipoate metabolic process | SoyBase | N/A | ISS |
| GO:0009108 | GO-bp | Annotation by Michelle Graham. GO Biological Process: coenzyme biosynthetic process | SoyBase | N/A | ISS |
| GO:0009117 | GO-bp | Annotation by Michelle Graham. GO Biological Process: nucleotide metabolic process | SoyBase | N/A | ISS |
| GO:0009408 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to heat | SoyBase | N/A | ISS |
| GO:0009416 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to light stimulus | SoyBase | N/A | ISS |
| GO:0009695 | GO-bp | Annotation by Michelle Graham. GO Biological Process: jasmonic acid biosynthetic process | SoyBase | N/A | ISS |
| GO:0009965 | GO-bp | Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis | SoyBase | N/A | ISS |
| GO:0010028 | GO-bp | Annotation by Michelle Graham. GO Biological Process: xanthophyll cycle | SoyBase | N/A | ISS |
| GO:0015994 | GO-bp | Annotation by Michelle Graham. GO Biological Process: chlorophyll metabolic process | SoyBase | N/A | ISS |
| GO:0015995 | GO-bp | Annotation by Michelle Graham. GO Biological Process: chlorophyll biosynthetic process | SoyBase | N/A | ISS |
| GO:0016117 | GO-bp | Annotation by Michelle Graham. GO Biological Process: carotenoid biosynthetic process | SoyBase | N/A | ISS |
| GO:0016122 | GO-bp | Annotation by Michelle Graham. GO Biological Process: xanthophyll metabolic process | SoyBase | N/A | ISS |
| GO:0019216 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of lipid metabolic process | SoyBase | N/A | ISS |
| GO:0019288 | GO-bp | Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway | SoyBase | N/A | ISS |
| GO:0019748 | GO-bp | Annotation by Michelle Graham. GO Biological Process: secondary metabolic process | SoyBase | N/A | ISS |
| GO:0030154 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cell differentiation | SoyBase | N/A | ISS |
| GO:0031408 | GO-bp | Annotation by Michelle Graham. GO Biological Process: oxylipin biosynthetic process | SoyBase | N/A | ISS |
| GO:0044272 | GO-bp | Annotation by Michelle Graham. GO Biological Process: sulfur compound biosynthetic process | SoyBase | N/A | ISS |
| GO:0045893 | GO-bp | Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent | SoyBase | N/A | ISS |
| GO:0055114 | GO-bp | Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process | SoyBase | N/A | ISS |
| GO:0009507 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast | SoyBase | N/A | ISS |
| GO:0009534 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid | SoyBase | N/A | ISS |
| GO:0009543 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid lumen | SoyBase | N/A | ISS |
| GO:0030095 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast photosystem II | SoyBase | N/A | ISS |
| GO:0031977 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: thylakoid lumen | SoyBase | N/A | ISS |
| GO:0005515 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein binding | SoyBase | N/A | ISS |
| GO:0046422 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: violaxanthin de-epoxidase activity | SoyBase | N/A | ISS |
| PF07137 | PFAM | Violaxanthin de-epoxidase (VDE) | JGI | ISS | |
| UniRef100_G0Z355 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=G0Z355_SOYBN | SoyBase | E_val: 0 | ISS |
| UniRef100_G7L300 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Violaxanthin de-epoxidase n=1 Tax=Medicago truncatula RepID=G7L300_MEDTR | SoyBase | E_val: 0 | ISS |
|
Glyma19g44010 not represented in the dataset |
Glyma19g44010 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Paralog | Evidence | Comments |
|---|---|---|
| Glyma03g41420 | IGC | Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3. |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.19g251000 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma19g44010.1 sequence type=CDS gene model=Glyma19g44010 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGGCAACGTGGGGTGCGCACTCAATGTTGTTATCCCATGGGGAAGGCACTGGCACTCCCAAAGTATGTGTAAAAGCAGGCCTTACGGTTAGAGGTGATTTAAGGTTTCACAGGACTAGAGGTTTTAAATATGCTCCTAGTGTGGTAGTGCTCAAAGTGTTGGCCACCGCCAGAAAGCCAACACGGTTGCGCTTGTTAAGACCTTATTGCAGTGTGAGGGGGCAACACGACCATGGGAAAGGATATTTTTCTCCCACTAATTCACAAATACCACGGCAACATATATTGAAATTCGCCGCGGATCGAATGCTTGCGTTTCTCAAAGATTGGAGTAATTTACGCATCACGGCAGTAGCTGGCATATTGGTATCCGTTTTAATGATCATTCCACCAGCTGATGCTGTTGACGCTCTCAAAACTTGTGCTTGCTTGTTGAAGGATTGCAGGATAGAACTGGCTAAGTGTCTTTCAAACCCATCTTGTGCGGCCAATATTGCTTGTCTTCAAACTTGCAACAATAGACCTGATGAGACCGAATGCCAAATTAAATGTGGGGACCTGTTTGAAAACAGTGTGGTTGATGAATTCAATGAATGTGCAGTATCACGGAAGAAATGTGTACCTAAGAAATCTGATGTGGGAGAATTTCCTGCTCCAAATCCTGATGTCCTTGTTAATAGCTTTAACATTGCTGAGTTCAGTGGCAAGTGGTTCATCACTAGTGGCTTAAATCCTACCTTCGATACCTTTGACTGCCAATTACATGAATTTCACACAGAATCCAACAAACTTGTGGGTAATTTGTCATGGAGAATACGGACTCCAGATGCTGGATTTATTACTAGGTCCGCTGAGCAGAGATTTGTACAAGATCCTTCCTATCCTGGGATCCTTTACAATCATGACAATAAGTACCTTCACTATCAAGATGACTGGTATATTTTGTCATCCAAGATTGAGAATAAATCAGATGACTACGTATTTGTATACTACCGAGGCAGAAACGATGCTTGGGATGGTTATGGAGGTGCTGTTGTATACACAAGGAGTGCAGTTTTGCCTGAATCTATAGTTCCTGAACTTGAAAAAGCATCTAAGAGTGTGGGAAGAGACTTTAGCAAGTTCATCAGGACAGATAACACATGCGGGCCAGAGCCTTCCCTGGTGGAAAGGCTGGAGAAAAAGGTAGAGGAAGGAGAAGAGACCATTGTAAGGGAAGTTGAACAGATAGAAGAAGAGGTGGAGAAGGTGGGGAAAACGGAGGCGACCTTATTTCAGAAGTTGGCAGAAGGGTTCAAAATGTTTCAAGAAGACGAGGAAAATTTCTTAAGAGGGTTATCAAAAGAAGAAATGGAGATTCTTGATGGGCTTAAAATGGAAGCCGGTGAAGTAGAAAAGCTCTTTGGACGTGCCTTGCCGATTAGGAAACTAAGATAA
>Glyma19g44010.1 sequence type=predicted peptide gene model=Glyma19g44010 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MATWGAHSMLLSHGEGTGTPKVCVKAGLTVRGDLRFHRTRGFKYAPSVVVLKVLATARKPTRLRLLRPYCSVRGQHDHGKGYFSPTNSQIPRQHILKFAADRMLAFLKDWSNLRITAVAGILVSVLMIIPPADAVDALKTCACLLKDCRIELAKCLSNPSCAANIACLQTCNNRPDETECQIKCGDLFENSVVDEFNECAVSRKKCVPKKSDVGEFPAPNPDVLVNSFNIAEFSGKWFITSGLNPTFDTFDCQLHEFHTESNKLVGNLSWRIRTPDAGFITRSAEQRFVQDPSYPGILYNHDNKYLHYQDDWYILSSKIENKSDDYVFVYYRGRNDAWDGYGGAVVYTRSAVLPESIVPELEKASKSVGRDFSKFIRTDNTCGPEPSLVERLEKKVEEGEETIVREVEQIEEEVEKVGKTEATLFQKLAEGFKMFQEDEENFLRGLSKEEMEILDGLKMEAGEVEKLFGRALPIRKLR*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||
|
|
|
