Glyma19g43460 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g43460

Feature Type:	gene_model
Chromosome:	Gm19
Start:	49117252
stop:	49118578
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g43460

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G04720	AT	Annotation by Michelle Graham. TAIR10: pathogenesis-related 4 \| chr3:1285691-1286531 REVERSE LENGTH=212	SoyBase	E_val: 4.00E-94	ISS
GO:0009615	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to virus	SoyBase	N/A	ISS
GO:0009627	GO-bp	Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0009723	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus	SoyBase	N/A	ISS
GO:0009817	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to fungus, incompatible interaction	SoyBase	N/A	ISS
GO:0010167	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to nitrate	SoyBase	N/A	ISS
GO:0015706	GO-bp	Annotation by Michelle Graham. GO Biological Process: nitrate transport	SoyBase	N/A	ISS
GO:0016998	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell wall macromolecule catabolic process	SoyBase	N/A	ISS
GO:0042742	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to bacterium	SoyBase	N/A	ISS
GO:0050832	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to fungus	SoyBase	N/A	ISS
GO:0080027	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to herbivore	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0004540	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ribonuclease activity	SoyBase	N/A	ISS
GO:0008061	GO-mf	Annotation by Michelle Graham. GO Molecular Function: chitin binding	SoyBase	N/A	ISS
PTHR22595	Panther	CHITINASE-RELATED	JGI		ISS
PTHR22595:SF1	Panther	WOUND-INDUCED PROTEIN WIN-RELATED	JGI		ISS
PF00187	PFAM	Chitin recognition protein	JGI		ISS
PF00967	PFAM	Barwin family	JGI		ISS
UniRef100_A0SWV6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Hevein-like n=1 Tax=Populus tremula x Populus alba RepID=A0SWV6_POPCN	SoyBase	E_val: 1.00E-111	ISS
UniRef100_C6T035	UniRef	Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=1 Tax=Glycine max RepID=C6T035_SOYBN	SoyBase	E_val: 2.00E-144	ISS

Expression Patterns of Glyma19g43460

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g43460

Paralog	Evidence	Comments
Glyma03g40770	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g43460 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g245400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g43460

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g43460

Limit To All Plant Sequences

>Glyma19g43460.1   sequence type=CDS   gene model=Glyma19g43460   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAAAAGCTTGGGTAGGCCTGGTGGTATTGCTGTGTTTGATTGTCACGGCCATCGCCGAACAATGCGGTCGTCAAGCTGGCGGGCAGACATGTCCCAACAACCTATGCTGCAGCCAGTACGGTTGGTGTGGAAACACCGAAGAATACTGTTCCCCTTCTAAGAACTGCCAGAGCAACTGCTGGGGAGGCGGCGGCGGTGGCGGTGGCGGCGGCGGCGGTGAAAGTGCTTCTAATGTCCGCGCCACATATCATTACTATGAGCCAGAGCAACACGGGTGGGACTTGAACGCCGTGAGTGCTTATTGCTCAACTTGGGACGCTAGCAAACCTTACTCATGGCGCAGTAAATATGGCTGGACCGCTTTCTGTGGTCCCGTTGGTCCTCGTGGCCGTGATTCTTGTGGAAAGTGCTTGCGGGTGACAAATACAGGAACAGGAGCAAACACAATTGTGAGAATCGTAGATCAGTGCAGCAACGGAGGGTTGGATTTGGACGTGGGAGTGTTCAATCGGATAGACACAGATGGAAGAGGATATCAACAGGGGCATCTCATTGTTAACTATCAGTTTGTGGATTGTGGGAATGAGCTCGACCTCACCAAACCTTTACTCTCCATCCTCGATGCTCCCTAA

Predicted protein sequences of Glyma19g43460

Limit To All Plant Sequences

>Glyma19g43460.1   sequence type=predicted peptide   gene model=Glyma19g43460   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGKAWVGLVVLLCLIVTAIAEQCGRQAGGQTCPNNLCCSQYGWCGNTEEYCSPSKNCQSNCWGGGGGGGGGGGGESASNVRATYHYYEPEQHGWDLNAVSAYCSTWDASKPYSWRSKYGWTAFCGPVGPRGRDSCGKCLRVTNTGTGANTIVRIVDQCSNGGLDLDVGVFNRIDTDGRGYQQGHLIVNYQFVDCGNELDLTKPLLSILDAP*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain