SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g42700

Feature Type:gene_model
Chromosome:Gm19
Start:48601816
stop:48604036
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma19g42700
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G52580AT Annotation by Michelle Graham. TAIR10: Ribosomal protein S11 family protein | chr3:19503324-19504701 FORWARD LENGTH=150 SoyBaseE_val: 2.00E-90ISS
GO:0001510GO-bp Annotation by Michelle Graham. GO Biological Process: RNA methylation SoyBaseN/AISS
GO:0006412GO-bp Annotation by Michelle Graham. GO Biological Process: translation SoyBaseN/AISS
GO:0009664GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall organization SoyBaseN/AISS
GO:0042545GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall modification SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005840GO-cc Annotation by Michelle Graham. GO Cellular Compartment: ribosome SoyBaseN/AISS
GO:0022627GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosolic small ribosomal subunit SoyBaseN/AISS
GO:0003735GO-mf Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome SoyBaseN/AISS
KOG0407 KOG 40S ribosomal protein S14 JGI ISS
PTHR11759Panther 40S RIBOSOMAL PROTEIN S14/30S RIBOSOMAL PROTEIN S11 JGI ISS
PF00411PFAM Ribosomal protein S11 JGI ISS
UniRef100_B3TM39UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ribosomal protein S14 n=1 Tax=Elaeis guineensis RepID=B3TM39_ELAGV SoyBaseE_val: 3.00E-91ISS
UniRef100_C6SV94UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=C6SV94_SOYBN SoyBaseE_val: 6.00E-103ISS

Expression Patterns of Glyma19g42700
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g42700
ParalogEvidenceComments
Glyma03g40110 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g42700 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g238600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma19g42700
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma19g42700
>Glyma19g42700.1   sequence type=CDS   gene model=Glyma19g42700   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCGAGGAGAAAGGTTAGAGAGCCAAAGGAGGAAAACGTGACTCTGGGCCCAGCTGTTAGAGATGGTGAACATGTTTTTGGAGTCGCTCGCATCTTTGCCTCCTTCAATGACACCTTCATTCATGTCACTGATCTGTCTGGGAGGGAAACACTTGTCCGCATCACTGGCGGGATGAAGGTTAAAGCTGACAGAGATGAATCATCTCCATATGCTGCTATGCTTGCTGCGCAGGATGTTGCTGCTAGATGCAAGGAACTGGGCATAACTGCTCTTCATATCAAGCTCCGTGCCACAGGTGGAAACAAGACAAAAACACCAGGTCCTGGTGCTCAATCAGCTCTTCGAGCCCTTGCTCGTTCAGGAATGAAAATTGGTCGCATAGAGGATGTGACCCCCATTCCTTCCGATAGCACACGGAGAAAGAGTGGTAGAAGGGGTAGAAGGCTTTAA
Predicted protein sequences of Glyma19g42700
>Glyma19g42700.1   sequence type=predicted peptide   gene model=Glyma19g42700   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSRRKVREPKEENVTLGPAVRDGEHVFGVARIFASFNDTFIHVTDLSGRETLVRITGGMKVKADRDESSPYAAMLAAQDVAARCKELGITALHIKLRATGGNKTKTPGPGAQSALRALARSGMKIGRIEDVTPIPSDSTRRKSGRRGRRL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo