Glyma19g42200 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma19g42200): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma19g42200): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma19g42200

Feature Type:	gene_model
Chromosome:	Gm19
Start:	48219653
stop:	48220522
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g42200

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G15800	AT	Annotation by Michelle Graham. TAIR10: ralf-like 33 \| chr4:8984915-8985265 FORWARD LENGTH=116	SoyBase	E_val: 3.00E-37	ISS
GO:0007267	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell-cell signaling	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0009505	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plant-type cell wall	SoyBase	N/A	ISS
GO:0009506	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma	SoyBase	N/A	ISS
GO:0048046	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: apoplast	SoyBase	N/A	ISS
GO:0004871	GO-mf	Annotation by Michelle Graham. GO Molecular Function: signal transducer activity	SoyBase	N/A	ISS
PF05498	PFAM	Rapid ALkalinization Factor (RALF)	JGI		ISS
UniRef100_A2Q327	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Rapid ALkalinization Factor n=1 Tax=Medicago truncatula RepID=A2Q327_MEDTR	SoyBase	E_val: 1.00E-45	ISS
UniRef100_I1NBY0	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1NBY0_SOYBN	SoyBase	E_val: 2.00E-90	ISS

Expression Patterns of Glyma19g42200

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g42200 not represented in the dataset	Glyma19g42200 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g42200

Paralog	Evidence	Comments
Glyma03g39580	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g42200 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g233700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g42200

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g42200

Limit To All Plant Sequences

>Glyma19g42200.2   sequence type=CDS   gene model=Glyma19g42200   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATATTCCAACAACCTTCAAAGACAGAGAAGAAAGAAGAAAACAACCTCAACAAACAAACATCAATGGCAAACACGTATTCGTGGCTCTTCCTCGCGATTTGTGCCACCCTCTTGCTTCTTCTGTCTTCGTCGCCGACAGCGGACGCGGGAGCGCTGGGCATGGAAATGACATGGATACCCTCCATGCCCATGGAAGAGGAGTTCCAGCTGGACAGCGAGATCAGCCGGCGCATCTTAGCCACGACCAAGTACATCAGCTACGGTGCGCTGCAGAGGAACACTGTCCCCTGCTCTCGCCGCGGAGCCTCCTACTACAATTGCCAGCCTGGCGCCCAGGCCAACCCTTACAGCCGTGGCTGCAGTGCCATCACCAGGTGCAGGAGCTAA

Predicted protein sequences of Glyma19g42200

Limit To All Plant Sequences

>Glyma19g42200.2   sequence type=predicted peptide   gene model=Glyma19g42200   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MIFQQPSKTEKKEENNLNKQTSMANTYSWLFLAICATLLLLLSSSPTADAGALGMEMTWIPSMPMEEEFQLDSEISRRILATTKYISYGALQRNTVPCSRRGASYYNCQPGAQANPYSRGCSAITRCRS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain