Glyma19g42030 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma19g42030): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma19g42030): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma19g42030

Feature Type:	gene_model
Chromosome:	Gm19
Start:	48120593
stop:	48122472
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g42030

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G05590	AT	Annotation by Michelle Graham. TAIR10: ribosomal protein L18 \| chr3:1621511-1622775 FORWARD LENGTH=187	SoyBase	E_val: 2.00E-117	ISS
GO:0006412	GO-bp	Annotation by Michelle Graham. GO Biological Process: translation	SoyBase	N/A	ISS
GO:0009220	GO-bp	Annotation by Michelle Graham. GO Biological Process: pyrimidine ribonucleotide biosynthetic process	SoyBase	N/A	ISS
GO:0005622	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: intracellular	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005773	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuole	SoyBase	N/A	ISS
GO:0005774	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane	SoyBase	N/A	ISS
GO:0005840	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: ribosome	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0015934	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: large ribosomal subunit	SoyBase	N/A	ISS
GO:0022625	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosolic large ribosomal subunit	SoyBase	N/A	ISS
GO:0003735	GO-mf	Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
KOG1714	KOG	60s ribosomal protein L18	JGI		ISS
PTHR10934	Panther	60S RIBOSOMAL PROTEIN L18	JGI		ISS
PF00828	PFAM	Ribosomal protein L18e/L15	JGI		ISS
UniRef100_B9SAT7	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: 60S ribosomal protein L18, putative n=1 Tax=Ricinus communis RepID=B9SAT7_RICCO	SoyBase	E_val: 7.00E-121	ISS
UniRef100_I1NBV9	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NBV9_SOYBN	SoyBase	E_val: 1.00E-130	ISS

Expression Patterns of Glyma19g42030

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g42030 not represented in the dataset	Glyma19g42030 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g42030

Paralog	Evidence	Comments
Glyma03g39420	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g42030 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g232100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g42030

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Transcripts of Glyma19g42030

Limit To All Plant Sequences

>Glyma19g42030.2   sequence type=transcript   gene model=Glyma19g42030   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
CAGAAGTGTGGTGCTCGAAGAAGTCCCATTCATTGCACTGATAGCAGCGATGGGGATCGATCTTAAGGCTGGGGGTAAGAGCAAAAAGACCAAAAGAACAGCACCAAAGTCCAATGACATCTACCTCAAATTACTTGTCAAGGTTCCTCAAATTAATCTTTTTGCTACCAAAAGAATAACACCGTAGTCTTACTCTTACTGTATGTGGAGTTAGTATCTTTCTTATGACGTTGTAATGGACTTAAGGTTCCCAGTGATGCTGTCTTTTTGACCATGCTAATGCTGATAACATATGATTATTACTTTCATTATACTGAGGGAACTAGTTCTTTTTGTTTTTGTTGTCTGTTGAATTTTAAGCACTTTAAGTTTGCTTAAGCTTTTACTAGTTTCAGACTTCAGAATTAATTGTTTCTTTGCTATCTATAAATTTGTAATTGTATTCTGGTCACATGAATGTTTTCTTAATTAGTCATGTATTGTATTATTCTGATTAAATGTTACTTGATCAGCTTTATCGATTCCTTGTTCGAAGGACAGACAGCAATTTCAATGCTGTGATACTCAAGCGCTTGTTCATGAGCAAGGTTAACAAGCCTCCAATTTCTTTGTCAAGGTTAATTAAGTATACGAAGGGGAAGGAGGATAAAATTGCTGTAGTAGTGGGGACTGTAACTGATGATATCAGAGTATATGAAGTTCCAGCATTGAAAATTACAGCACTCAAGTTTACAGAGAGAGCACGTGCAAGAATAGAAAAGGCTGGCGGTGAATGCTTGACATTTGATCAGCTTGCCCTTAGGGCTCCTTTGGGACAGAATACGGTCCTTCTTAGAGGCCCCAAGAATGCTCGGGAAGCTGTGAAACACTTTGGTCCTGCTCCTGGTGTGCCACACAGCCATACCAAGCCCTATGTACGAGCAAAGGGAAGGAAGTTCGAGAGGGCTAGAGGAAGGAGGAACAGCAGAGGATTTAGAGTTTAAGAAGATAACTTGGTTCTAATTTTTTTTACAAGTGTTCACTTCTGAAATTCAACTTTTTGCTATAGGCGTTGGTGACAGGTTTTATGATATATTTCTGTTACAAGACATCGTGAGTCGTTTTACATTGACGTGTACTAAAAAAACTAGCATTAGGTTTTGATTCCCCCTATTGAAAGGCTAGTCATTTTTTCGTGATCTGCTTGTCCTCCGATTGATTGGCTACTCTTTATAATGTTGCACCCCCTGCCCTATCTCTTTCCAAAATTCTATTTATATGTATTTAGTAAGCTATAGATTAATCATAAGTTGTTTAAGATC

Coding sequences of Glyma19g42030

Limit To All Plant Sequences

>Glyma19g42030.1   sequence type=CDS   gene model=Glyma19g42030   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGGATCGATCTTAAGGCTGGGGGTAAGAGCAAAAAGACCAAAAGAACAGCACCAAAGTCCAATGACATCTACCTCAAATTACTTGTCAAGCTTTATCGATTCCTTGTTCGAAGGACAGACAGCAATTTCAATGCTGTGATACTCAAGCGCTTGTTCATGAGCAAGGTTAACAAGCCTCCAATTTCTTTGTCAAGGTTAATTAAGTATACGAAGGGGAAGGAGGATAAAATTGCTGTAGTAGTGGGGACTGTAACTGATGATATCAGAGTATATGAAGTTCCAGCATTGAAAATTACAGCACTCAAGTTTACAGAGAGAGCACGTGCAAGAATAGAAAAGGCTGGCGGTGAATGCTTGACATTTGATCAGCTTGCCCTTAGGGCTCCTTTGGGACAGAATACGGTCCTTCTTAGAGGCCCCAAGAATGCTCGGGAAGCTGTGAAACACTTTGGTCCTGCTCCTGGTGTGCCACACAGCCATACCAAGCCCTATGTACGAGCAAAGGGAAGGAAGTTCGAGAGGGCTAGAGGAAGGAGGAACAGCAGAGGATTTAGAGTTTAA

>Glyma19g42030.2   sequence type=CDS   gene model=Glyma19g42030   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTACTTGATCAGCTTTATCGATTCCTTGTTCGAAGGACAGACAGCAATTTCAATGCTGTGATACTCAAGCGCTTGTTCATGAGCAAGGTTAACAAGCCTCCAATTTCTTTGTCAAGGTTAATTAAGTATACGAAGGGGAAGGAGGATAAAATTGCTGTAGTAGTGGGGACTGTAACTGATGATATCAGAGTATATGAAGTTCCAGCATTGAAAATTACAGCACTCAAGTTTACAGAGAGAGCACGTGCAAGAATAGAAAAGGCTGGCGGTGAATGCTTGACATTTGATCAGCTTGCCCTTAGGGCTCCTTTGGGACAGAATACGGTCCTTCTTAGAGGCCCCAAGAATGCTCGGGAAGCTGTGAAACACTTTGGTCCTGCTCCTGGTGTGCCACACAGCCATACCAAGCCCTATGTACGAGCAAAGGGAAGGAAGTTCGAGAGGGCTAGAGGAAGGAGGAACAGCAGAGGATTTAGAGTTTAA

Predicted protein sequences of Glyma19g42030

Limit To All Plant Sequences

>Glyma19g42030.1   sequence type=predicted peptide   gene model=Glyma19g42030   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGIDLKAGGKSKKTKRTAPKSNDIYLKLLVKLYRFLVRRTDSNFNAVILKRLFMSKVNKPPISLSRLIKYTKGKEDKIAVVVGTVTDDIRVYEVPALKITALKFTERARARIEKAGGECLTFDQLALRAPLGQNTVLLRGPKNAREAVKHFGPAPGVPHSHTKPYVRAKGRKFERARGRRNSRGFRV*

>Glyma19g42030.2   sequence type=predicted peptide   gene model=Glyma19g42030   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLLDQLYRFLVRRTDSNFNAVILKRLFMSKVNKPPISLSRLIKYTKGKEDKIAVVVGTVTDDIRVYEVPALKITALKFTERARARIEKAGGECLTFDQLALRAPLGQNTVLLRGPKNAREAVKHFGPAPGVPHSHTKPYVRAKGRKFERARGRRNSRGFRV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain