Glyma19g41410 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g41410

Feature Type:	gene_model
Chromosome:	Gm19
Start:	47687263
stop:	47690879
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g41410

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G66460	AT	Annotation by Michelle Graham. TAIR10: Glycosyl hydrolase superfamily protein \| chr5:26538911-26540837 REVERSE LENGTH=431	SoyBase	E_val: 5.00E-159	ISS
GO:0008152	GO-bp	Annotation by Michelle Graham. GO Biological Process: metabolic process	SoyBase	N/A	ISS
GO:0009845	GO-bp	Annotation by Michelle Graham. GO Biological Process: seed germination	SoyBase	N/A	ISS
GO:0009855	GO-bp	Annotation by Michelle Graham. GO Biological Process: determination of bilateral symmetry	SoyBase	N/A	ISS
GO:0009944	GO-bp	Annotation by Michelle Graham. GO Biological Process: polarity specification of adaxial/abaxial axis	SoyBase	N/A	ISS
GO:0010014	GO-bp	Annotation by Michelle Graham. GO Biological Process: meristem initiation	SoyBase	N/A	ISS
GO:0010075	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of meristem growth	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0003824	GO-mf	Annotation by Michelle Graham. GO Molecular Function: catalytic activity	SoyBase	N/A	ISS
GO:0004553	GO-mf	Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, hydrolyzing O-glycosyl compounds	SoyBase	N/A	ISS
GO:0043169	GO-mf	Annotation by Michelle Graham. GO Molecular Function: cation binding	SoyBase	N/A	ISS
PF00150	PFAM	Cellulase (glycosyl hydrolase family 5)	JGI		ISS
UniRef100_G7KWG8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Mannan endo-1,4-beta-mannosidase n=1 Tax=Medicago truncatula RepID=G7KWG8_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_UPI000233E74B	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233E74B related cluster n=1 Tax=unknown RepID=UPI000233E74B	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma19g41410

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g41410

Paralog	Evidence	Comments
Glyma03g38840	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g41410 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g226300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g41410

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g41410

Limit To All Plant Sequences

>Glyma19g41410.2   sequence type=CDS   gene model=Glyma19g41410   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGATTCCAAAACTTGGTGTTGATGGCTTTTATGATGACATTGATTGTTATTGGTCAATACGAACATTGCATGGCTACTGGTCGTCTTCATTTTCATCATCACTCACACAAAAACTTAACCACCAAAAAACTTCATGGTGGTTTCATTGAACGAAGTAACACCCATTTTTATCTCAATGGAAAACCACACTACTTAAATGGATTCAATTCGTATTGGTTAATGAATGTAGCATCCGATCCATCTACAAGTTCTAAGGTCAGTATAACTTTTCAAGAAGCTTCCCAACATGGTTTGAATGTAGCAAGAACTTGGGCATTCAACGATGGAGGTTACAATGCCCTTCAAATTTCTCCTGGTTCTTACAACGAGAATGTCTTCAAGGGATTGGATTTTGTAATTTCAGAAGCAGGAAAAAATGGGGTACGACTGATACTAAGTCTAGTAAATAACTGGAATGATTATGGTGGAAAGAGTCAGTATGTTCAATGGGCAAGAGAACGTGGTCAATATGTAAACAACGACGATGACTTCTTCTCACACCCCATTGTTAAGGAATACTACAAAAATCACGTCAAGACTATGCTGACAAGAAAGAATACTATAACTGGATTGACATATCAGAATGATCCAACAATTTTTGCATGGGAACTTATGAATGAACCTCGTTCCCAAAATGACTATTCTGGAAAATCAATTCAGGATTGGGTGAGGGAGATGGCTGCCTATGTGAAGTCTATTGATAACAATCATTTACTTGAAGTAGGACTTGAAGGATTTTATGGTGAATCAATGCCGGATAAGAAACAATTCAATCCTGGATATCAAGTAGGAACTGATTTCATTTCTAACAACCAAGTTCCTGAAATCGATTTCACCACCATCCATCTCTACCCTGATCAATGGGTATCAAACTCTAATGAAAGTGCTAAAGATGATTTTGTTAGCAAATGGGTCCAAGCCCATATCCAGGACTCAAACGACATTTTAGGAAAACCCATTCTTTTTACTGAGTTTGGAAAGTCTTCAAAGTCTTCAGGATACAGTGTTGATAAAAGGGACAATTACTTTGAAAAAATATACAATTTCATATTCAACAGTGCTAGCAATGGGGGACCATGTGCAGGTGGACTTTTTTGGCAACTAATGACACAGGGAATGGATGACTTGCATGATGGCAATGAAATCATCTGTGATGAGAATCCTTCAACTGCCAATGTCATCACTCAACAATCTAAAAAGATGTCAAATCTAGGATAA

Predicted protein sequences of Glyma19g41410

Limit To All Plant Sequences

>Glyma19g41410.2   sequence type=predicted peptide   gene model=Glyma19g41410   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGFQNLVLMAFMMTLIVIGQYEHCMATGRLHFHHHSHKNLTTKKLHGGFIERSNTHFYLNGKPHYLNGFNSYWLMNVASDPSTSSKVSITFQEASQHGLNVARTWAFNDGGYNALQISPGSYNENVFKGLDFVISEAGKNGVRLILSLVNNWNDYGGKSQYVQWARERGQYVNNDDDFFSHPIVKEYYKNHVKTMLTRKNTITGLTYQNDPTIFAWELMNEPRSQNDYSGKSIQDWVREMAAYVKSIDNNHLLEVGLEGFYGESMPDKKQFNPGYQVGTDFISNNQVPEIDFTTIHLYPDQWVSNSNESAKDDFVSKWVQAHIQDSNDILGKPILFTEFGKSSKSSGYSVDKRDNYFEKIYNFIFNSASNGGPCAGGLFWQLMTQGMDDLHDGNEIICDENPSTANVITQQSKKMSNLG*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain