SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g41070

Feature Type:gene_model
Chromosome:Gm19
Start:47390045
stop:47391131
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma19g41070
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G02335AT Annotation by Michelle Graham. TAIR10: germin-like protein subfamily 2 member 2 precursor | chr1:463979-464876 REVERSE LENGTH=219 SoyBaseE_val: 2.00E-78ISS
GO:0010497GO-bp Annotation by Michelle Graham. GO Biological Process: plasmodesmata-mediated intercellular transport SoyBaseN/AISS
GO:2000280GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of root development SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0030145GO-mf Annotation by Michelle Graham. GO Molecular Function: manganese ion binding SoyBaseN/AISS
GO:0045735GO-mf Annotation by Michelle Graham. GO Molecular Function: nutrient reservoir activity SoyBaseN/AISS
PF00190PFAM Cupin JGI ISS
UniRef100_C7S8D0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Germin-like protein 16 n=1 Tax=Glycine max RepID=C7S8D0_SOYBN SoyBaseE_val: 4.00E-92ISS
UniRef100_UPI000233E742UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233E742 related cluster n=1 Tax=unknown RepID=UPI000233E742 SoyBaseE_val: 2.00E-121ISS

Expression Patterns of Glyma19g41070
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma19g41070 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g222800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma19g41070
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma19g41070
>Glyma19g41070.2   sequence type=CDS   gene model=Glyma19g41070   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
CTATTCATACAATTTGTCGTCTCCATTGCCTACGCTTCTGATCCCGACGCACTTCAAGACCTTTGTGTCGCTTTTCCCTCCTCCAGTGTGAAGATGAATGGATTTGCATGCAAGGAGGAGGCAAATGTGACAGAAGCAGATTTCTTCTTTGCTGGGCTAGCGAATCCCGGAGTTATCAACAACGCAACGGGGTCAGTAGTCACTGCAGCCAATACTTCAAACCCACCTCACACACATCCTCGTGCCACCGAGATTCTGTTCGTGTTGGAAGGAGAACTTGACGTGGGTTTCATCACCACAGCCAACAAACTCATCTCCAAAACCGTAAAAGAAGGTGAAGTGTTTGTGTTCCCGAAAGCTTTGGTGCACTTTCAGAAGAACAATGGGGATAAGCCTGCTGCTGTTATTTCTGCGTTTGATAGCCAACTCCCTGGCACATTCTCTATAGTTGCGGTTTTGTTTAATTCTACCCCAAGTGTGCCTGATGATGTGCTCACACATGCCTTCCAGATTGATACTCAAGACGTTGACAAGATCAAGAACAGTCTTTCCTAG
Predicted protein sequences of Glyma19g41070
>Glyma19g41070.2   sequence type=predicted peptide   gene model=Glyma19g41070   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
LFIQFVVSIAYASDPDALQDLCVAFPSSSVKMNGFACKEEANVTEADFFFAGLANPGVINNATGSVVTAANTSNPPHTHPRATEILFVLEGELDVGFITTANKLISKTVKEGEVFVFPKALVHFQKNNGDKPAAVISAFDSQLPGTFSIVAVLFNSTPSVPDDVLTHAFQIDTQDVDKIKNSLS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo