Report for Sequence Feature Glyma19g40770
Feature Type: gene_model
Chromosome: Gm19
Start: 47090355
stop: 47092000
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma19g40770
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT2G47140 AT
Annotation by Michelle Graham. TAIR10: NAD(P)-binding Rossmann-fold superfamily protein | chr2:19350970-19352059 REVERSE LENGTH=257
SoyBase E_val: 1.00E-120 ISS
GO:0008152 GO-bp
Annotation by Michelle Graham. GO Biological Process: metabolic process
SoyBase N/A ISS
GO:0005737 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm
SoyBase N/A ISS
GO:0000166 GO-mf
Annotation by Michelle Graham. GO Molecular Function: nucleotide binding
SoyBase N/A ISS
GO:0016491 GO-mf
Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity
SoyBase N/A ISS
KOG0725
KOG
Reductases with broad range of substrate specificities
JGI ISS
PTHR24322 Panther
FAMILY NOT NAMED
JGI ISS
PF00106 PFAM
short chain dehydrogenase
JGI ISS
UniRef100_G7KTR5 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Xanthoxin dehydrogenase n=1 Tax=Medicago truncatula RepID=G7KTR5_MEDTR
SoyBase E_val: 5.00E-148 ISS
UniRef100_UPI0001890B2F UniRef
Annotation by Michelle Graham. Best UniRef hit: UPI0001890B2F related cluster n=1 Tax=unknown RepID=UPI0001890B2F
SoyBase E_val: 0 ISS
Expression Patterns of Glyma19g40770
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma19g40770
Paralog Evidence Comments
Glyma03g38160 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma19g40770 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.19g219800 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma19g40770
Coding sequences of Glyma19g40770
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma19g40770.1 sequence type=CDS gene model=Glyma19g40770 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGACAAAACAAAGTTCTAGGTTGGAGGGTAAGGTGGCTCTTATCACTGGAGCAGCAAGTGGGATTGGTGAAGAGACAGTGAGATTGTTCGCTGAACATGGAGCACTTATTGTTGCAACAGATATTCAAGATGAACAAGGTCACCGAGTTGCTGCTTCAATAGGGTCAGAGAGAGTGACTTACCATCATTGTGATGTGAGAGATGAAAACCAAGTTGAAGAAACAATCAATTTCACTTTGGAAAAACATGGTCGCATAGATGTTTTGTTCAGCAACGCTGGAGTAATAGGTTCCTTATCTGGGATCCTTGACCTTGATCTGAATGAGTTTGACAACACCATGGCCACAAATGTTCGTGGTGTAGCTGCCACAATTAAGCACACGGCACGTGCCATGGTTGCTAAAAGCACCCGTGGATCCATCATATGCACCACTAGTGTGGCTGCTACTATTGGTGGAACAGGTCCTCATGGTTATACCACATCAAAACATGCTCTTCTGGGGTTGGTGAAATCAGCTTGTAGTGAACTTGGTGCTTATGGAATAAGAGTTAATAGCATATCCCCTTTCGGAGTTGCAACACCTCTTGCATGCAAAGCTTTCAACTTTGAGCCTGAGCAAGTTGAAGCTAATAGCTGCTCACAGGCTAATCTGAAGGGTGTTGTGTTGAAGGCTAGGCATATAGCTGAAGCAGCTTTGTTTCTTGCTTCTGATGATGCTGCTGTTTACATCAGTGGTCACAACTTGGTGGTGGATGGTGGGTTCTCTGTGGTTAATAGAAGTTATTCTTTCACACCAGCTTAA
Predicted protein sequences of Glyma19g40770
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma19g40770.1 sequence type=predicted peptide gene model=Glyma19g40770 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MTKQSSRLEGKVALITGAASGIGEETVRLFAEHGALIVATDIQDEQGHRVAASIGSERVTYHHCDVRDENQVEETINFTLEKHGRIDVLFSNAGVIGSLSGILDLDLNEFDNTMATNVRGVAATIKHTARAMVAKSTRGSIICTTSVAATIGGTGPHGYTTSKHALLGLVKSACSELGAYGIRVNSISPFGVATPLACKAFNFEPEQVEANSCSQANLKGVVLKARHIAEAALFLASDDAAVYISGHNLVVDGGFSVVNRSYSFTPA*