SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Notice: fwrite(): Write of 157 bytes failed with errno=28 No space left on device in /var/www/html/include/SeqFeatClass.php on line 369

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma19g39830): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma19g39830): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma19g39830

Feature Type:gene_model
Chromosome:Gm19
Start:46377293
stop:46380609
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G02860AT Annotation by Michelle Graham. TAIR10: SPX (SYG1/Pho81/XPR1) domain-containing protein | chr1:635474-637083 FORWARD LENGTH=335 SoyBaseE_val: 2.00E-164ISS
GO:0006817GO-bp Annotation by Michelle Graham. GO Biological Process: phosphate ion transport SoyBaseN/AISS
GO:0009626GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type hypersensitive response SoyBaseN/AISS
GO:0009627GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance SoyBaseN/AISS
GO:0009697GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process SoyBaseN/AISS
GO:0009751GO-bp Annotation by Michelle Graham. GO Biological Process: response to salicylic acid stimulus SoyBaseN/AISS
GO:0010167GO-bp Annotation by Michelle Graham. GO Biological Process: response to nitrate SoyBaseN/AISS
GO:0010337GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of salicylic acid metabolic process SoyBaseN/AISS
GO:0016036GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to phosphate starvation SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0080021GO-bp Annotation by Michelle Graham. GO Biological Process: response to benzoic acid stimulus SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0004842GO-mf Annotation by Michelle Graham. GO Molecular Function: ubiquitin-protein ligase activity SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
PTHR23041Panther RING FINGER PROTEIN 4 JGI ISS
PTHR23041:SF6Panther PUTATIVE RING FINGER PROTEIN JGI ISS
PF03105PFAM SPX domain JGI ISS
UniRef100_B9SAP8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ubiquitin-protein ligase, putative n=1 Tax=Ricinus communis RepID=B9SAP8_RICCO SoyBaseE_val: 0ISS
UniRef100_I1NB57UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NB57_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g39830 not represented in the dataset

Glyma19g39830 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma03g37210 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g210900 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma19g39830.1   sequence type=CDS   gene model=Glyma19g39830   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGTTCTGCAAAAAGTATCAGGAATACATGCAAGGCCAGGAGAAGAAACTTCCATGTGTAGGATTCAAGAAGCTCAAGAAGATTCTGAAGAAGTGCAGGAGAAACTCTTCATCCCTGAAACCCCTTAATGCATCCCTTGCCGCCAAAACCTGCCCCGACCATTGCCCAGTGTGCGATGGGACCTTCTTCCCTTCCCTTCTCAATGAAATGTCAGATATAGTGGGGTGCTTTAATCAGCGGGCGCAGAAATTGTTGGAGCTACATCTCGCTTCTGGGGTCAGAAAGTACTTCTTCTGGATCAAAGGCAAATTACAAGGGAACCATACTGCACTGATTCAAGAGGGCAAAGATCTTGTTACTTATGCACTCATAAATGCCATTGCAATTCGAAAAATACTAAAGAAATATGATAAGATTCATTATTCCAAGCAAGGGCAATTGTTCAAGTCACAAGTCCAGAGTATGCACAAGGAGATTCTTCAAAGTCCCTGGCTTTGTGAGCTTATGGCCTTCCACATCAATTTAAGGGAAACTAAGGTCAAGTCAAGGAAGGCACATGCTTTGTTCGATGGATGTTCTCTCACATTCAAGGATGGGAAACCGTCACTTACTTGTGAGCTCTTTGATTCTATCAAAGTTGACATTGACTTGACTTGTTCTATATGCTTGGACACAGTGTTTGATCCAGTTTCTCTGACTTGTGGCCATATATTCTGCTATATTTGTGCATGCTCGGCTGCATCGGTATCTATTGTCAATGGACTTAAGTCTGCAGATCCTAAAATGAAATGTCCTCTATGTCGTGAGGGTGCAGTTTATGAAGGTGCTGTGCGCTTGGAAGAACTAAATATTCTGTTAAGCCGAAGTTGTCAGGAATACTGGGAGCAGAGGCTTCAGACAGAGAGGGTGGAGAGGGTTAAGCAAATAAAGGAACACTGGGATTCACAGTGTAGGGCATTCGTGGGCGTCTAA

>Glyma19g39830.1   sequence type=predicted peptide   gene model=Glyma19g39830   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKFCKKYQEYMQGQEKKLPCVGFKKLKKILKKCRRNSSSLKPLNASLAAKTCPDHCPVCDGTFFPSLLNEMSDIVGCFNQRAQKLLELHLASGVRKYFFWIKGKLQGNHTALIQEGKDLVTYALINAIAIRKILKKYDKIHYSKQGQLFKSQVQSMHKEILQSPWLCELMAFHINLRETKVKSRKAHALFDGCSLTFKDGKPSLTCELFDSIKVDIDLTCSICLDTVFDPVSLTCGHIFCYICACSAASVSIVNGLKSADPKMKCPLCREGAVYEGAVRLEELNILLSRSCQEYWEQRLQTERVERVKQIKEHWDSQCRAFVGV*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo