Glyma19g39680 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g39680

Feature Type:	gene_model
Chromosome:	Gm19
Start:	46281786
stop:	46283212
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g39680

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G27490	AT	Annotation by Michelle Graham. TAIR10: dephospho-CoA kinase family \| chr2:11748087-11749009 REVERSE LENGTH=232	SoyBase	E_val: 2.00E-116	ISS
GO:0015824	GO-bp	Annotation by Michelle Graham. GO Biological Process: proline transport	SoyBase	N/A	ISS
GO:0015937	GO-bp	Annotation by Michelle Graham. GO Biological Process: coenzyme A biosynthetic process	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005773	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuole	SoyBase	N/A	ISS
GO:0005777	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: peroxisome	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0004140	GO-mf	Annotation by Michelle Graham. GO Molecular Function: dephospho-CoA kinase activity	SoyBase	N/A	ISS
GO:0005524	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP binding	SoyBase	N/A	ISS
KOG3220	KOG	Similar to bacterial dephospho-CoA kinase	JGI		ISS
PTHR10695	Panther	DEPHOSPHO-COA RELATED KINASES	JGI		ISS
PF01121	PFAM	Dephospho-CoA kinase	JGI		ISS
UniRef100_G7ISC8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Dephospho-CoA kinase n=1 Tax=Medicago truncatula RepID=G7ISC8_MEDTR	SoyBase	E_val: 5.00E-141	ISS
UniRef100_I1NB41	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NB41_SOYBN	SoyBase	E_val: 2.00E-169	ISS

Expression Patterns of Glyma19g39680

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g39680

Paralog	Evidence	Comments
Glyma03g37050	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g39680 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g209400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g39680

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g39680

Limit To All Plant Sequences

>Glyma19g39680.1   sequence type=CDS   gene model=Glyma19g39680   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGGATCGTTGGACTGACGGGTGGAATAGCGTCTGGAAAGAGCACCGTTTCCAATCTGTTCAAGTCCCATGATGTTCCCATTGTAGATGCTGACGTTGTCGCTCGCGAGGTGTTAATGAAAGGGAGTGGTGGTTGGAAGAAAGTCGTTGCAGCTTTTGGGGACGAAATTCTTCTTGAAAATGGAGAAGTCAATAGACCCAGGCTTGGCCAAATTGTCTTCTCCGATCCGGATAAGCGTCAATTTCTCAACCGATTGCTAGCTCCTTACATATCACGTGGGATATTTTGGAAGGTTTTGAAGCTATGGATGAAGGGATACAAGGTCATTGTTCTTGATGTGCCTTTGTTATTCGAGGCCAAGATGGACAAGTTCACAAAGCCCATTATTGTTGTATGGGTTGATCCTGAGACGCAGATTCAGCGGCTCTTGGCGAGAGACAAATCCAGTGAGGAGGATGCTCGGAATAGGATTAATGCTCAAATGTCACTGGATGTTAAAAGGGGTAAAGCTGATATAGTTATAGATAACACTGGTTCATTGGATGACTTGAATCAACAGTTTCAGAAGGTTTTTGTTGAGGTCACAAGGCCATTGACATGGACTGAGTTTTTGCGCTCCAGGCAGGGAGTCTTCGCCATTCTTGCTTCCTTCACCTCAGGTGTTGTTCTGTTTATGAAGACATTCAACAATCATACCCACATTTCATAG

Predicted protein sequences of Glyma19g39680

Limit To All Plant Sequences

>Glyma19g39680.1   sequence type=predicted peptide   gene model=Glyma19g39680   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRIVGLTGGIASGKSTVSNLFKSHDVPIVDADVVAREVLMKGSGGWKKVVAAFGDEILLENGEVNRPRLGQIVFSDPDKRQFLNRLLAPYISRGIFWKVLKLWMKGYKVIVLDVPLLFEAKMDKFTKPIIVVWVDPETQIQRLLARDKSSEEDARNRINAQMSLDVKRGKADIVIDNTGSLDDLNQQFQKVFVEVTRPLTWTEFLRSRQGVFAILASFTSGVVLFMKTFNNHTHIS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain