SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g39070

Feature Type:gene_model
Chromosome:Gm19
Start:45875895
stop:45877259
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma19g39070
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G03850AT Annotation by Michelle Graham. TAIR10: Nucleic acid-binding, OB-fold-like protein | chr5:1028542-1028736 REVERSE LENGTH=64 SoyBaseE_val: 8.00E-34ISS
GO:0006407GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA export from nucleus SoyBaseN/AISS
GO:0006412GO-bp Annotation by Michelle Graham. GO Biological Process: translation SoyBaseN/AISS
GO:0042254GO-bp Annotation by Michelle Graham. GO Biological Process: ribosome biogenesis SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005840GO-cc Annotation by Michelle Graham. GO Cellular Compartment: ribosome SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0022627GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosolic small ribosomal subunit SoyBaseN/AISS
GO:0003735GO-mf Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome SoyBaseN/AISS
KOG3502 KOG 40S ribosomal protein S28 JGI ISS
PTHR10769Panther RIBOSOMAL PROTEIN S28 JGI ISS
PF01200PFAM Ribosomal protein S28e JGI ISS
UniRef100_C6SZ18UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=C6SZ18_SOYBN SoyBaseE_val: 7.00E-38ISS
UniRef100_G7KLD3UniRef Annotation by Michelle Graham. Most informative UniRef hit: 30S ribosomal protein S28e n=2 Tax=Medicago truncatula RepID=G7KLD3_MEDTR SoyBaseE_val: 3.00E-37ISS

Expression Patterns of Glyma19g39070
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g39070
ParalogEvidenceComments
Glyma03g36420 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g39070 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g203300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma19g39070
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma19g39070
>Glyma19g39070.1   sequence type=CDS   gene model=Glyma19g39070   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGTCTCAGGTGAAGCACGCACTTGTTGTCAAAGTTATGGGTCGTACTGGATCCAGAGGACAAGTGACCCAGGTTAGAGTGAAGTTTTTGGATGATCAGAACCGTCACATCATGAGGAATGTGAAAGGACCTGTGAGAGAAGGAGACATTCTCACCCTACTCGAGTCTGAAAGGGAAGCAAGAAGATTGCGCTAG
Predicted protein sequences of Glyma19g39070
>Glyma19g39070.1   sequence type=predicted peptide   gene model=Glyma19g39070   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MESQVKHALVVKVMGRTGSRGQVTQVRVKFLDDQNRHIMRNVKGPVREGDILTLLESEREARRLR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo