SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g38790

Feature Type:gene_model
Chromosome:Gm19
Start:45644941
stop:45647216
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma19g38790
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G52380AT Annotation by Michelle Graham. TAIR10: chloroplast RNA-binding protein 33 | chr3:19421619-19422855 FORWARD LENGTH=329 SoyBaseE_val: 6.00E-100ISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0016226GO-bp Annotation by Michelle Graham. GO Biological Process: iron-sulfur cluster assembly SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0048481GO-bp Annotation by Michelle Graham. GO Biological Process: ovule development SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003723GO-mf Annotation by Michelle Graham. GO Molecular Function: RNA binding SoyBaseN/AISS
KOG0131 KOG Splicing factor 3b, subunit 4 JGI ISS
PTHR24012Panther FAMILY NOT NAMED JGI ISS
PTHR24012:SF56Panther SUBFAMILY NOT NAMED JGI ISS
PF00076PFAM RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) JGI ISS
UniRef100_I1NAV4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NAV4_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q08948UniRef Annotation by Michelle Graham. Most informative UniRef hit: 33 kd chloroplast ribonucleoprotein n=1 Tax=Nicotiana sylvestris RepID=Q08948_NICSY SoyBaseE_val: 5.00E-104ISS

Expression Patterns of Glyma19g38790
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g38790
ParalogEvidenceComments
Glyma03g36130 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g38790 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g200700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma19g38790
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma19g38790
>Glyma19g38790.1   sequence type=CDS   gene model=Glyma19g38790   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGCTACGGCTTCTGTTTCCTCTTCTATCTGCAACAGAATATACAACCTTTCCTTCACACACCCTTCCCTTTCACTCACCAGCAGCAACTTCCCTCAAAGACCCGTATCTCAAAAACCACTCAGTCTCAACCTCGAGTCCCAAAGTTTCGCTCTTTCCTTTCTCCCACTTCACCGTCTTCCCCCACCTTTCGCTGCCTTTGATGGGTTGGAAGTAGCTCAAGATACCACAGAGTCCCAACAAGACGAACCAGAACCAGAAACCGTTGAAAAAACAGAACAAGAGGAAGAGCAAAAGGTTTCAGACTCCAATGATGCTGGGAGGCTCTATGTTGGAAACTTGCCATATTCAATCACTAATTCCGAATTGGGCGAGCTCTTTGGAGAAGCTGGCACCGTGGCGTCTGTTGAGATTGTGTATGATCGTGTCACGGATAGAAGCAGGGGATTTGCATTTGTTACAATGGGGAGTGTTGAGGATGCTAAAGAGGCAATTCGAATGTTTGATGGCTCTCAAGTTGGTGGTAGGACTGTTAAGGTAAACTTCCCAGAGGTACCTAAAGGAGGGGAAAGGTTGGTAATGGGGTCAAAAATACTGAACAGCTACAGAGGCTTTGTAGACAGCCCTCACAAGATCTATGCTGGCAACCTAGGCTGGGGATTGACCTCACAGGGTCTTAGGGAAGCTTTTGCTGAGCAGCCAGGCGTATTGAGTGCCAAGGTCATCTATGAGAGGGACAGTGGAAGATCTCGAGGTTTTGGGTTTGTTTCTTTTGAAACTGCCGAATCTGCACGGGCTGCTTTGGACATCATGAATGGTGTGGAGGTACAAGGTCGGCCCTTGCGGTTGAATTTGGCTGAAGCAAGGACACCTTCATCTCCTCCAGTAATTCAGAAAAATGTAGGAAGCAATGTTGAAAGTTCGGAATTGGTGTCTAGTGCCAGCACATAA
Predicted protein sequences of Glyma19g38790
>Glyma19g38790.1   sequence type=predicted peptide   gene model=Glyma19g38790   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAATASVSSSICNRIYNLSFTHPSLSLTSSNFPQRPVSQKPLSLNLESQSFALSFLPLHRLPPPFAAFDGLEVAQDTTESQQDEPEPETVEKTEQEEEQKVSDSNDAGRLYVGNLPYSITNSELGELFGEAGTVASVEIVYDRVTDRSRGFAFVTMGSVEDAKEAIRMFDGSQVGGRTVKVNFPEVPKGGERLVMGSKILNSYRGFVDSPHKIYAGNLGWGLTSQGLREAFAEQPGVLSAKVIYERDSGRSRGFGFVSFETAESARAALDIMNGVEVQGRPLRLNLAEARTPSSPPVIQKNVGSNVESSELVSSAST*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo