SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g38085

Feature Type:gene_model
Chromosome:Gm19
Start:45095328
stop:45102492
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma19g38085
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G52660AT Annotation by Michelle Graham. TAIR10: RNA-binding (RRM/RBD/RNP motifs) family protein | chr3:19522598-19524735 FORWARD LENGTH=471 SoyBaseE_val: 5.00E-42ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003723GO-mf Annotation by Michelle Graham. GO Molecular Function: RNA binding SoyBaseN/AISS
KOG0148 KOG Apoptosis-promoting RNA-binding protein TIA-1/TIAR (RRM superfamily) JGI ISS
PTHR24011Panther FAMILY NOT NAMED JGI ISS
PTHR24011:SF198Panther JGI ISS
PF00076PFAM RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) JGI ISS
UniRef100_G7KQW4UniRef Annotation by Michelle Graham. Most informative UniRef hit: RNA-binding protein n=1 Tax=Medicago truncatula RepID=G7KQW4_MEDTR SoyBaseE_val: 4.00E-66ISS
UniRef100_I1JQ30UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1JQ30_SOYBN SoyBaseE_val: 2.00E-79ISS

Expression Patterns of Glyma19g38085
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g38085 not represented in the dataset
Glyma19g38085 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g38085
ParalogEvidenceComments
Glyma03g35450 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g38085 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma19g38085
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma19g38085
>Glyma19g38085.1   sequence type=CDS   gene model=Glyma19g38085   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCCTGGGACGAGGCAGAGAGATACAGCTCAAAATCTAGAGTCACCAGAGGGGAACAGTGAGCTTGAGAAACCTACAGATTCTGATGAGCAAGTAGACTTTGATGGGGACAATGATCAAGAGGAGACAATGGAGGAAGTTGAGTATGAAGAAAAAAAGAAGCATGCTGAGCTTCTTGCACTTCCACCTCATGGGTCTGAGGTTTACATTGGGGGCATTTCTCCAAATGTTTCCGAAGAAGATTTGAGGGTCTTCTGTCAATCCGTGGGAGAAGTTTCAGAGGTTAGGATAATGAAGGGAAAAGAAACCAGTGAAGCAAAAGGTTATGCTTTTGTGACCTTCAAGACAAAGGAATTGGCATATAAGGCTATTAAGGAGCTGAACAACTCTGAATTTAAGGTAAAATTAGTGTATGTAAAGAACCTTCCAGAAAACATTACTCAGGATCGTCTTAAGGAGCTGTCTGAACATCATGGAAAGATCACAAAAGTGGTTCTCCCTTCTGCTAAAACCGGGCAAGAAAAGAGCAGATTTGGTTTTGTTCACTTTGCTGAAAGGTCAAGTGCCATGAAGGCTTTGAAGAACGCAGAGAAATATGAAATTGATGGACAAACGTTGGAGTGTTCACTAGCAAAGCCACAAGCAAATTCACATAAGCCAGCTGTACTTCCTGCTTATCCACCTCATCTTGGTTATGGTGGTATGATTGGTAGTGCTATAGGTGCAGGATTTGATGGAAGGATTGCATACATAGTGCAACAGCCAGGGTTTCAACAGCCTGCTCCAATGCCAGTATCCCGACATGGGAGGAGTGGTGGCGGTAGCTCAAGTGGTGGGAAATGCAGTAATGATAATAACAGCAATCGTGGACATGGCCGCTATCATCCCTACTAA
Predicted protein sequences of Glyma19g38085
>Glyma19g38085.1   sequence type=predicted peptide   gene model=Glyma19g38085   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MPGTRQRDTAQNLESPEGNSELEKPTDSDEQVDFDGDNDQEETMEEVEYEEKKKHAELLALPPHGSEVYIGGISPNVSEEDLRVFCQSVGEVSEVRIMKGKETSEAKGYAFVTFKTKELAYKAIKELNNSEFKVKLVYVKNLPENITQDRLKELSEHHGKITKVVLPSAKTGQEKSRFGFVHFAERSSAMKALKNAEKYEIDGQTLECSLAKPQANSHKPAVLPAYPPHLGYGGMIGSAIGAGFDGRIAYIVQQPGFQQPAPMPVSRHGRSGGGSSSGGKCSNDNNSNRGHGRYHPY*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo