SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g37910

Feature Type:gene_model
Chromosome:Gm19
Start:44997977
stop:45003243
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma19g37910
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G36270AT Annotation by Michelle Graham. TAIR10: Basic-leucine zipper (bZIP) transcription factor family protein | chr2:15204980-15206571 REVERSE LENGTH=442 SoyBaseE_val: 1.00E-108ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009686GO-bp Annotation by Michelle Graham. GO Biological Process: gibberellin biosynthetic process SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009738GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0009739GO-bp Annotation by Michelle Graham. GO Biological Process: response to gibberellin stimulus SoyBaseN/AISS
GO:0009740GO-bp Annotation by Michelle Graham. GO Biological Process: gibberellic acid mediated signaling pathway SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010182GO-bp Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway SoyBaseN/AISS
GO:0010187GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of seed germination SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0019915GO-bp Annotation by Michelle Graham. GO Biological Process: lipid storage SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0048316GO-bp Annotation by Michelle Graham. GO Biological Process: seed development SoyBaseN/AISS
GO:0050826GO-bp Annotation by Michelle Graham. GO Biological Process: response to freezing SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0043565GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding SoyBaseN/AISS
GO:0046983GO-mf Annotation by Michelle Graham. GO Molecular Function: protein dimerization activity SoyBaseN/AISS
PTHR22952Panther CAMP-RESPONSE ELEMENT BINDING PROTEIN-RELATED JGI ISS
PTHR22952:SF35Panther SUBFAMILY NOT NAMED JGI ISS
PF00170PFAM bZIP transcription factor JGI ISS
UniRef100_G7L631UniRef Annotation by Michelle Graham. Most informative UniRef hit: Abscisic acid insensitive n=1 Tax=Medicago truncatula RepID=G7L631_MEDTR SoyBaseE_val: 3.00E-138ISS
UniRef100_I1NAM6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NAM6_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma19g37910
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma19g37910 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g194500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma19g37910
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma19g37910
>Glyma19g37910.1   sequence type=CDS   gene model=Glyma19g37910   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTGATTGAGGAGGGCGAGATGAAGTCCCAAGGTGAGGTGGAATCATGGCTCCAGCAAGAAGCGAAGAAGAACCACCATTCTCCATTATTCTCATCTTCTTCATATCTGGGAAGACAAACATCATCGATATACTCTCTCACACTGGACGAGTTCCAGCACAGTCTATGCGAGAGCGGCAAGAACTTCGGCTCCATGAACATGGACGAGTTCCTCAGCAGCATCTGGAACGCTGAAGAGAACAGCCAAGCCATCACCAACAACAACGTCCCTCTGTCGTCGACCCTAACAATATTAAGGAAACAGCCAAGCCTCCCTCGCCAACCCTCACTGTCCCTCCCTGCTCCTCTTTGTAGGAAAACCGTTGACGAGGTTTGGTCCCAGATTCAAAAAGAACAAAACAAGAACAACAACATTAGCAATGTTCTTAATGATAATACCGAGTCTGCCCCTCGCCAACCCACTTTTGGTGAGATGACTTTGGAGGATTTTTTGGTTAAGGCCGGTGTAGTTCGGGAAACAACGTGTGCACCGCCACTACCGGTGTCTCACTCTCATCAGCCGCATTACGCGAATAATAACAACAACGTTGCAATGGCTCCTTCTTTTGTTGGTAGGCATGTTGGTGCAGTGAGTAACGTGGTTGCACCGGGTTATCAACAAGTTGTTGGGGAGGCTTCTGGTGGGTATGGTAAGAGGGATCATAATGGTGGTGGGTATCATTGTTTTGGAGGTGGTGGTGGTGGGTATGGGGTGGGGCCCACAATGGGAATGGGTGGGCCTGTGAGTCCGGCTAATTCGTCTGATGGGATAGGGAATGATGGAGGGCAGTTTGGGCTTGACATGGGGGGTTTGAGAGGGAGAAAGAGGGTGGTGGATGGTCCTGTGGAAAAGGTGGTGGAGAGAAGGCAGAGGAGGATGATCAAGAATAGAGAGTCAGCTGCCAGATCTAGAGCCAGAAAACAGGCATACACAGTGGAATTAGAAGCAGAACTAAACCAGTTAAGAGAAGAGAACTCCCAACTGAAACAGGCGCTGGCCGAGCTCGAGAGGGGAAGAAAACAACAGTGTTTTGAGGAAGTGAACGTTAGTGTTAAAACCAAAGCTCAGAAAGCAAAAGAGAAACTGAGAGCTTTGAGAAGGAACATGAGTTGTCCTTTGTGA
Predicted protein sequences of Glyma19g37910
>Glyma19g37910.1   sequence type=predicted peptide   gene model=Glyma19g37910   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVIEEGEMKSQGEVESWLQQEAKKNHHSPLFSSSSYLGRQTSSIYSLTLDEFQHSLCESGKNFGSMNMDEFLSSIWNAEENSQAITNNNVPLSSTLTILRKQPSLPRQPSLSLPAPLCRKTVDEVWSQIQKEQNKNNNISNVLNDNTESAPRQPTFGEMTLEDFLVKAGVVRETTCAPPLPVSHSHQPHYANNNNNVAMAPSFVGRHVGAVSNVVAPGYQQVVGEASGGYGKRDHNGGGYHCFGGGGGGYGVGPTMGMGGPVSPANSSDGIGNDGGQFGLDMGGLRGRKRVVDGPVEKVVERRQRRMIKNRESAARSRARKQAYTVELEAELNQLREENSQLKQALAELERGRKQQCFEEVNVSVKTKAQKAKEKLRALRRNMSCPL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo