SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g37640

Feature Type:gene_model
Chromosome:Gm19
Start:44743496
stop:44744403
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma19g37640
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G36460AT Annotation by Michelle Graham. TAIR10: Aldolase superfamily protein | chr2:15296929-15297732 REVERSE LENGTH=267 SoyBaseE_val: 2.00E-16ISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004332GO-mf Annotation by Michelle Graham. GO Molecular Function: fructose-bisphosphate aldolase activity SoyBaseN/AISS
GO:0005507GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion binding SoyBaseN/AISS
PTHR11627Panther FRUCTOSE-BISPHOSPHATE ALDOLASE JGI ISS
PF00274PFAM Fructose-bisphosphate aldolase class-I JGI ISS
UniRef100_I1NAJ8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1NAJ8_SOYBN SoyBaseE_val: 2.00E-111ISS
UniRef100_Q94FU4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Fructose-bisphosphate aldolase (Fragment) n=1 Tax=Solanum lycopersicum RepID=Q94FU4_SOLLC SoyBaseE_val: 8.00E-15ISS

Expression Patterns of Glyma19g37640
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g37640
ParalogEvidenceComments
Glyma03g34950 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g37640 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma19g37640
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma19g37640
>Glyma19g37640.1   sequence type=CDS   gene model=Glyma19g37640   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
AAGGCTATCCTTGTTGCTGATGAGTCAAGTGGTACAATTGGAAGGCATTTGGCCAGCATTAATTTAATGTCGAGAATGTTGAAGCAAATAGGCGTGCTCTTCGGGAACTCCTATTCACCACACCTGGAAACCCTATACCAAAAGACAGCTTCAGTATCTACTAATCTAGTAAGAGGATTAGTAGATATACTAAATGCATTGACTTGCTCATATATTATTTTCTTTATAAAGAAGACCCTTCGTAGAGTTGTTGAAGGAAGGTGGAGTTCTTGCTGGGAAATTGGAAGGGCAGTTCAGCAGAGCACTCTCAAGGCATGGGGTGGGAAAGATGAAAACATTAAGAAGGCTCAGGGTGCCTTCATTGCTAGGTGCAAGGCAAACTCACGTGCAACTTTGGGAGAACTTACAAGGGTGATGCTACCCTTGCTGAGGGTGCCTCCGAGTCTCTCCATGTCAAGGACTACAAATACTAACTAG
Predicted protein sequences of Glyma19g37640
>Glyma19g37640.1   sequence type=predicted peptide   gene model=Glyma19g37640   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
KAILVADESSGTIGRHLASINLMSRMLKQIGVLFGNSYSPHLETLYQKTASVSTNLVRGLVDILNALTCSYIIFFIKKTLRRVVEGRWSSCWEIGRAVQQSTLKAWGGKDENIKKAQGAFIARCKANSRATLGELTRVMLPLLRVPPSLSMSRTTNTN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo