Report for Sequence Feature Glyma19g37040
Feature Type: gene_model
Chromosome: Gm19
Start: 44295450
stop: 44296145
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma19g37040
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT1G67540 AT
Annotation by Michelle Graham. TAIR10: unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: petal, leaf whorl, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 29
SoyBase E_val: 2.00E-20 ISS
GO:0008150 GO-bp
Annotation by Michelle Graham. GO Biological Process: biological process
SoyBase N/A ISS
GO:0005739 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
UniRef100_I1NAD4 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1NAD4_SOYBN
SoyBase E_val: 2.00E-151 ISS
Expression Patterns of Glyma19g37040
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma19g37040
Paralog Evidence Comments
Glyma03g34351 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma19g37040 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.19g186500 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma19g37040
Coding sequences of Glyma19g37040
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma19g37040.2 sequence type=CDS gene model=Glyma19g37040 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGAACTCAAGGCATCGTCCATTACATGCTAGTGGAGTCTCCATCTTAGCAACTGTTGACATTGCCATAGAAAAAACACAACATATCAATGGACCATTAGGTTCAACATTGAGAAGGGTAGCAAATTTAGCCAAATTTGCCACCCCTTTTATCTACGCCATGCAAATCCAATGGCTAACAATTCTCTCCTTCATCGATGATGCCATTCTAGCAATTGAAAAATTTACGGAGAAATTGTTTCCCCCTTCAACCCACGTGTTCGACATAGTTGATGAAATTGTGCTAATGATAGTGTTCCTGCCAGAAAAATTTGATGGTGCGGTGAACAAGTTTTCTACAATAATCCACCAAGTGCCATTCTTGGATTGGGCACTGACCCTTGTAATCTCAAGGTTGAACAGATTGGTTTCCACGTTGAACTATTGGGGACATGAAAATTCAAGAGTAAACGAGAAAACAATAGGTGTTGATAGGAGTTGCAATGAAGGGTACCTTCCCATGGATTCCTCGGATGATATTAACCATGAGAGTTTGGAAAATTTTCCTCCTATGATACCAGAATGTGAACATAAAGCGGTTCATGACATTTCATTGTCGAGTCGTGTAAAAGGGTCATACAAGGAAGCATTGGAGAGGGGGAAAGAAGAGACCCCAAATGAGAAAATGGAGAGAGAGTGTGAGATTGTTGAGAATTGA
Predicted protein sequences of Glyma19g37040
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma19g37040.2 sequence type=predicted peptide gene model=Glyma19g37040 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MNSRHRPLHASGVSILATVDIAIEKTQHINGPLGSTLRRVANLAKFATPFIYAMQIQWLTILSFIDDAILAIEKFTEKLFPPSTHVFDIVDEIVLMIVFLPEKFDGAVNKFSTIIHQVPFLDWALTLVISRLNRLVSTLNYWGHENSRVNEKTIGVDRSCNEGYLPMDSSDDINHESLENFPPMIPECEHKAVHDISLSSRVKGSYKEALERGKEETPNEKMERECEIVEN*