Report for Sequence Feature Glyma19g37020
Feature Type: gene_model
Chromosome: Gm19
Start: 44285137
stop: 44289218
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma19g37020
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT5G03530 AT
Annotation by Michelle Graham. TAIR10: RAB GTPase homolog C2A | chr5:885741-887061 REVERSE LENGTH=210
SoyBase E_val: 7.00E-127 ISS
GO:0006355 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0007264 GO-bp
Annotation by Michelle Graham. GO Biological Process: small GTPase mediated signal transduction
SoyBase N/A ISS
GO:0015031 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein transport
SoyBase N/A ISS
GO:0005777 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: peroxisome
SoyBase N/A ISS
GO:0005794 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus
SoyBase N/A ISS
GO:0005515 GO-mf
Annotation by Michelle Graham. GO Molecular Function: protein binding
SoyBase N/A ISS
GO:0005524 GO-mf
Annotation by Michelle Graham. GO Molecular Function: ATP binding
SoyBase N/A ISS
GO:0005525 GO-mf
Annotation by Michelle Graham. GO Molecular Function: GTP binding
SoyBase N/A ISS
GO:0008134 GO-mf
Annotation by Michelle Graham. GO Molecular Function: transcription factor binding
SoyBase N/A ISS
GO:0030742 GO-mf
Annotation by Michelle Graham. GO Molecular Function: GTP-dependent protein binding
SoyBase N/A ISS
GO:0080115 GO-mf
Annotation by Michelle Graham. GO Molecular Function: myosin XI tail binding
SoyBase N/A ISS
KOG0080
KOG
GTPase Rab18, small G protein superfamily
JGI ISS
PTHR24073 Panther
FAMILY NOT NAMED
JGI ISS
PTHR24073:SF482 Panther
JGI ISS
PF00071 PFAM
Ras family
JGI ISS
UniRef100_I1NAD3 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NAD3_SOYBN
SoyBase E_val: 6.00E-149 ISS
UniRef100_Q40206 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: RAB1X n=1 Tax=Lotus japonicus RepID=Q40206_LOTJA
SoyBase E_val: 1.00E-132 ISS
Expression Patterns of Glyma19g37020
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma19g37020
Paralog Evidence Comments
Glyma03g34330 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma19g37020 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.19g186300 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma19g37020
Coding sequences of Glyma19g37020
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma19g37020.1 sequence type=CDS gene model=Glyma19g37020 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGAGTTCATCCTCAGGTCAGAGCAGTGGCTATGATCTCTCTTTCAAGATCTTGTTGATCGGAGATTCCGGTGTGGGAAAAAGTAGCCTACTAGTCAGCTTTATTTCAAGTTCTGTTGAAGATCTTTCCCCCACCATTGGTGTTGATTTTAAGATCAAAACGCTCACAGTGGGTGGCAAGAGATTGAAATTGACGATTTGGGATACTGCTGGGCAGGAAAGGTTCAGGACTCTAAACAGTTCTTACTATAGAAAAGCACAAGGAATCATTCTCGTTTATGATGTCACAAGGAGAGAAACCTTTACAAACTTATCAGAAGTGTGGTCTAAGGAAGTGGAACTCTACTCAACTAATCAGGATTGTGTGAAGATACTAGTTGGAAATAAAGTTGATAGAGATACTGAAAGGGCTGTGAGCAGGGAAGAGGGTTTAGCACTTGCTAAAGATTTGGGGTGTTTGCTTCTTGAATGTAGTGCCAAAACAAGGGAAAATGTGGAGCAGTGCTTTGAGGAACTTGCTCTAAAGATAATGGAAGCTCCTAGTCTTTTGGAAGAAGGATCAACAGCAGTTAAAAGGAGTGTTTTAAAACCAAAACAAGAATCCCAAGCATCCCAAAATGGTGGTTGTTGCTCTTAA
Predicted protein sequences of Glyma19g37020
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma19g37020.1 sequence type=predicted peptide gene model=Glyma19g37020 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MSSSSGQSSGYDLSFKILLIGDSGVGKSSLLVSFISSSVEDLSPTIGVDFKIKTLTVGGKRLKLTIWDTAGQERFRTLNSSYYRKAQGIILVYDVTRRETFTNLSEVWSKEVELYSTNQDCVKILVGNKVDRDTERAVSREEGLALAKDLGCLLLECSAKTRENVEQCFEELALKIMEAPSLLEEGSTAVKRSVLKPKQESQASQNGGCCS*