SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g37000

Feature Type:gene_model
Chromosome:Gm19
Start:44258426
stop:44259853
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma19g37000
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G36830AT Annotation by Michelle Graham. TAIR10: gamma tonoplast intrinsic protein | chr2:15445490-15446336 FORWARD LENGTH=251 SoyBaseE_val: 1.00E-144ISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006598GO-bp Annotation by Michelle Graham. GO Biological Process: polyamine catabolic process SoyBaseN/AISS
GO:0006810GO-bp Annotation by Michelle Graham. GO Biological Process: transport SoyBaseN/AISS
GO:0006816GO-bp Annotation by Michelle Graham. GO Biological Process: calcium ion transport SoyBaseN/AISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0006972GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic response SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0009266GO-bp Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus SoyBaseN/AISS
GO:0009269GO-bp Annotation by Michelle Graham. GO Biological Process: response to desiccation SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009698GO-bp Annotation by Michelle Graham. GO Biological Process: phenylpropanoid metabolic process SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009740GO-bp Annotation by Michelle Graham. GO Biological Process: gibberellic acid mediated signaling pathway SoyBaseN/AISS
GO:0015840GO-bp Annotation by Michelle Graham. GO Biological Process: urea transport SoyBaseN/AISS
GO:0042398GO-bp Annotation by Michelle Graham. GO Biological Process: cellular modified amino acid biosynthetic process SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0055085GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane transport SoyBaseN/AISS
GO:0080170GO-bp Annotation by Michelle Graham. GO Biological Process: hydrogen peroxide transmembrane transport SoyBaseN/AISS
GO:0000326GO-cc Annotation by Michelle Graham. GO Cellular Compartment: protein storage vacuole SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0009705GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plant-type vacuole membrane SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0016021GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane SoyBaseN/AISS
GO:0042807GO-cc Annotation by Michelle Graham. GO Cellular Compartment: central vacuole SoyBaseN/AISS
GO:0005215GO-mf Annotation by Michelle Graham. GO Molecular Function: transporter activity SoyBaseN/AISS
GO:0015204GO-mf Annotation by Michelle Graham. GO Molecular Function: urea transmembrane transporter activity SoyBaseN/AISS
GO:0015250GO-mf Annotation by Michelle Graham. GO Molecular Function: water channel activity SoyBaseN/AISS
KOG0223 KOG Aquaporin (major intrinsic protein family) JGI ISS
PTHR19139Panther AQUAPORIN TRANSPORTER JGI ISS
PTHR19139:SF52Panther SUBFAMILY NOT NAMED JGI ISS
PF00230PFAM Major intrinsic protein JGI ISS
UniRef100_C6T4J5UniRef Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=1 Tax=Glycine max RepID=C6T4J5_SOYBN SoyBaseE_val: 2.00E-159ISS
UniRef100_Q39882UniRef Annotation by Michelle Graham. Most informative UniRef hit: Nodulin-26 n=1 Tax=Glycine max RepID=Q39882_SOYBN SoyBaseE_val: 5.00E-158ISS

Expression Patterns of Glyma19g37000
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g37000
ParalogEvidenceComments
Glyma03g34310 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g37000 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g186100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma19g37000
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma19g37000
>Glyma19g37000.1   sequence type=CDS   gene model=Glyma19g37000   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCCGATCAGAAACATCGCCGTCGGAAGGCCTGAAGAGGCGACTCACCCCGACACGTTGAAGGCGGCTTTGGCTGAGTTCATCTCAACCTTCATCTTCGTGTTCGCCGGCTCAGGCTCCGGCATCGCCTACAACAAGCTCACCGACAACGGCGCTGCCACCCCTGCCGGCCTCATCTCCGCCTCCATCGCCCATGCATTCGCCCTCTTCGTCGCCGTCTCCGTCGGCGCCAACATCTCCGGCGGCCACGTCAACCCCGCCGTCACCTTCGGCGCCTTCGTCGGCGGCAACATCACCTTCCTCCGCGGCATCGTCTACGTCATCGCCCAGCTCCTCGGCTCCATCGTCGCCTCCCTCCTCCTGGCCTTCGTCACCGCCTCCACTGTTCCAGCATTCGGACTCTCCGCTGGAGTTGGAGTTGGCAACGCCTTGGTGTTGGAGATCGTGATGACCTTCGGTCTGGTGTACACGGTCTACGCAACTGCCATTGACCCCAAGAAGGGTAATTTGGGAATTATTGCTCCCATCGCCATTGGTTTCATTGTCGGCGCTAACATTTTGTTGGGTGGGGCCTTCTCTGGAGCGGCCATGAACCCCGCTGTGACATTTGGGCCTGCTGTCGTGAGCTGGACCTGGACCAACCACTGGATCTACTGGGCCGGGCCTCTCATCGGTGGTGGAATCGCTGGCCTTGTTTACGAGGTTGTCTTTATCAGCCACACCCACGAGCAGCTTCCCACCACTGACTACTAG
Predicted protein sequences of Glyma19g37000
>Glyma19g37000.1   sequence type=predicted peptide   gene model=Glyma19g37000   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MPIRNIAVGRPEEATHPDTLKAALAEFISTFIFVFAGSGSGIAYNKLTDNGAATPAGLISASIAHAFALFVAVSVGANISGGHVNPAVTFGAFVGGNITFLRGIVYVIAQLLGSIVASLLLAFVTASTVPAFGLSAGVGVGNALVLEIVMTFGLVYTVYATAIDPKKGNLGIIAPIAIGFIVGANILLGGAFSGAAMNPAVTFGPAVVSWTWTNHWIYWAGPLIGGGIAGLVYEVVFISHTHEQLPTTDY*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo