Glyma19g36280 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g36280

Feature Type:	gene_model
Chromosome:	Gm19
Start:	43620568
stop:	43623301
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g36280

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G37090	AT	Annotation by Michelle Graham. TAIR10: Nucleotide-diphospho-sugar transferases superfamily protein \| chr2:15587671-15589223 REVERSE LENGTH=351	SoyBase	E_val: 2.00E-150	ISS
GO:0009832	GO-bp	Annotation by Michelle Graham. GO Biological Process: plant-type cell wall biogenesis	SoyBase	N/A	ISS
GO:0009834	GO-bp	Annotation by Michelle Graham. GO Biological Process: secondary cell wall biogenesis	SoyBase	N/A	ISS
GO:0010413	GO-bp	Annotation by Michelle Graham. GO Biological Process: glucuronoxylan metabolic process	SoyBase	N/A	ISS
GO:0010417	GO-bp	Annotation by Michelle Graham. GO Biological Process: glucuronoxylan biosynthetic process	SoyBase	N/A	ISS
GO:0042546	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell wall biogenesis	SoyBase	N/A	ISS
GO:0044036	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell wall macromolecule metabolic process	SoyBase	N/A	ISS
GO:0045492	GO-bp	Annotation by Michelle Graham. GO Biological Process: xylan biosynthetic process	SoyBase	N/A	ISS
GO:0005794	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0015018	GO-mf	Annotation by Michelle Graham. GO Molecular Function: galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity	SoyBase	N/A	ISS
GO:0016757	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring glycosyl groups	SoyBase	N/A	ISS
GO:0042285	GO-mf	Annotation by Michelle Graham. GO Molecular Function: xylosyltransferase activity	SoyBase	N/A	ISS
KOG1476	KOG	Beta-1,3-glucuronyltransferase B3GAT1/SQV-8	JGI		ISS
PTHR10896	Panther	BETA-1,3-GLUCURONYLTRANSFERASE	JGI		ISS
PTHR10896:SF1	Panther	BETA-1,3-GLUCURONYLTRANSFERASE-RELATED	JGI		ISS
PF03360	PFAM	Glycosyltransferase family 43	JGI		ISS
UniRef100_I1NA65	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NA65_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_Q599J6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Beta-3-glucuronyltransferase n=1 Tax=Medicago truncatula RepID=Q599J6_MEDTR	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma19g36280

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g36280

Paralog	Evidence	Comments
Glyma03g33570	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g36280 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g179100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g36280

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g36280

Limit To All Plant Sequences

>Glyma19g36280.1   sequence type=CDS   gene model=Glyma19g36280   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGTTCACTAGAAAGATCAAAGAAGAAAGTTCTTCTATGGAAGAAGGCCATGCTCCATTTTTCCCTATGTTTTTTGATGGGGGTTTTCACAGGCTTAGCTCCAACAGGTAAATCTTCTCTCTTTTCCACCAAAGTTGCTGTCTCAAATAGGACAGAATTTGCACCACAACCTAGTGAAATGTCAAACCTCACAACAAATGTCAATAGAATTTGGATAGCTCCAATGCCAGATACCATGCCCGTGAAGCCTAGAATCCTTGAAAATGAAAAGAAAAAAACAACAAAGTTGCATGCAAAAAAACAGCCCCAGTTGAAGCCTAGAAGACTCATAATCATTGTAACACCAACAAGCACAAAACTACCCCACCAAGCAGTGTTTTTGAGAAGGTTGGCAAATACTATAAAGCTGGTTCCTCAACCATTGCTGTGGATTGTTGTGGAAGCTAAAACCAATTCCACAGAACTGCCAGAGATATTAAGGAAAACTGGCATCATGTATAGGCATGTGGTTTTCAAGGAAAATTTCACGGAATTAGAAGCTGAACTGAATCACCAGAGGAATCTTGCACTTAAGCACATTGAGCACCACAGGCTCAACGGCATTGTACACTTTGCTGGCCTTTCCAATGTTTATGATCTCCAATTCTTCCATCAGCTTAGAGATATTGAGGTCTTTGGAACATGGCCAACCGCATTGTTAGCTGCACACAGGAAGAAAGTGAAAATCGAAGGACCTGTATGTGATTCATCACAAGTCATTGGTTGGCATCTTAGGAATATGAACAATGAAACTGATACAATCACTCCCCCAATTCATATTTCAAGTTTTGCTTTTAATAGCTCCATCCTTTGGGACCCTGAGAGATGGGGTCGCACTTCCTCTGTTCAAGACACTTCTCAGAATTCAATCAAGTTCGTGAAGCAAGTAGTTCTAGAAGATGAGGCTAAATTAAAGGGAATTCCACCAGAAGATTGCTCCAAAATCTTGCTATGGCGTTTCAATTTTCGTGCCCGAACCATCACAAATCACTAA

Predicted protein sequences of Glyma19g36280

Limit To All Plant Sequences

>Glyma19g36280.1   sequence type=predicted peptide   gene model=Glyma19g36280   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGSLERSKKKVLLWKKAMLHFSLCFLMGVFTGLAPTGKSSLFSTKVAVSNRTEFAPQPSEMSNLTTNVNRIWIAPMPDTMPVKPRILENEKKKTTKLHAKKQPQLKPRRLIIIVTPTSTKLPHQAVFLRRLANTIKLVPQPLLWIVVEAKTNSTELPEILRKTGIMYRHVVFKENFTELEAELNHQRNLALKHIEHHRLNGIVHFAGLSNVYDLQFFHQLRDIEVFGTWPTALLAAHRKKVKIEGPVCDSSQVIGWHLRNMNNETDTITPPIHISSFAFNSSILWDPERWGRTSSVQDTSQNSIKFVKQVVLEDEAKLKGIPPEDCSKILLWRFNFRARTITNH*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain