SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma19g36280

Feature Type:gene_model
Chromosome:Gm19
Start:43620568
stop:43623301
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G37090AT Annotation by Michelle Graham. TAIR10: Nucleotide-diphospho-sugar transferases superfamily protein | chr2:15587671-15589223 REVERSE LENGTH=351 SoyBaseE_val: 2.00E-150ISS
GO:0009832GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall biogenesis SoyBaseN/AISS
GO:0009834GO-bp Annotation by Michelle Graham. GO Biological Process: secondary cell wall biogenesis SoyBaseN/AISS
GO:0010413GO-bp Annotation by Michelle Graham. GO Biological Process: glucuronoxylan metabolic process SoyBaseN/AISS
GO:0010417GO-bp Annotation by Michelle Graham. GO Biological Process: glucuronoxylan biosynthetic process SoyBaseN/AISS
GO:0042546GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall biogenesis SoyBaseN/AISS
GO:0044036GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall macromolecule metabolic process SoyBaseN/AISS
GO:0045492GO-bp Annotation by Michelle Graham. GO Biological Process: xylan biosynthetic process SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0015018GO-mf Annotation by Michelle Graham. GO Molecular Function: galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity SoyBaseN/AISS
GO:0016757GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring glycosyl groups SoyBaseN/AISS
GO:0042285GO-mf Annotation by Michelle Graham. GO Molecular Function: xylosyltransferase activity SoyBaseN/AISS
KOG1476 KOG Beta-1,3-glucuronyltransferase B3GAT1/SQV-8 JGI ISS
PTHR10896Panther BETA-1,3-GLUCURONYLTRANSFERASE JGI ISS
PTHR10896:SF1Panther BETA-1,3-GLUCURONYLTRANSFERASE-RELATED JGI ISS
PF03360PFAM Glycosyltransferase family 43 JGI ISS
UniRef100_I1NA65UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NA65_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q599J6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Beta-3-glucuronyltransferase n=1 Tax=Medicago truncatula RepID=Q599J6_MEDTR SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma03g33570 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g179100 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma19g36280.1   sequence type=CDS   gene model=Glyma19g36280   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGTTCACTAGAAAGATCAAAGAAGAAAGTTCTTCTATGGAAGAAGGCCATGCTCCATTTTTCCCTATGTTTTTTGATGGGGGTTTTCACAGGCTTAGCTCCAACAGGTAAATCTTCTCTCTTTTCCACCAAAGTTGCTGTCTCAAATAGGACAGAATTTGCACCACAACCTAGTGAAATGTCAAACCTCACAACAAATGTCAATAGAATTTGGATAGCTCCAATGCCAGATACCATGCCCGTGAAGCCTAGAATCCTTGAAAATGAAAAGAAAAAAACAACAAAGTTGCATGCAAAAAAACAGCCCCAGTTGAAGCCTAGAAGACTCATAATCATTGTAACACCAACAAGCACAAAACTACCCCACCAAGCAGTGTTTTTGAGAAGGTTGGCAAATACTATAAAGCTGGTTCCTCAACCATTGCTGTGGATTGTTGTGGAAGCTAAAACCAATTCCACAGAACTGCCAGAGATATTAAGGAAAACTGGCATCATGTATAGGCATGTGGTTTTCAAGGAAAATTTCACGGAATTAGAAGCTGAACTGAATCACCAGAGGAATCTTGCACTTAAGCACATTGAGCACCACAGGCTCAACGGCATTGTACACTTTGCTGGCCTTTCCAATGTTTATGATCTCCAATTCTTCCATCAGCTTAGAGATATTGAGGTCTTTGGAACATGGCCAACCGCATTGTTAGCTGCACACAGGAAGAAAGTGAAAATCGAAGGACCTGTATGTGATTCATCACAAGTCATTGGTTGGCATCTTAGGAATATGAACAATGAAACTGATACAATCACTCCCCCAATTCATATTTCAAGTTTTGCTTTTAATAGCTCCATCCTTTGGGACCCTGAGAGATGGGGTCGCACTTCCTCTGTTCAAGACACTTCTCAGAATTCAATCAAGTTCGTGAAGCAAGTAGTTCTAGAAGATGAGGCTAAATTAAAGGGAATTCCACCAGAAGATTGCTCCAAAATCTTGCTATGGCGTTTCAATTTTCGTGCCCGAACCATCACAAATCACTAA

>Glyma19g36280.1   sequence type=predicted peptide   gene model=Glyma19g36280   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGSLERSKKKVLLWKKAMLHFSLCFLMGVFTGLAPTGKSSLFSTKVAVSNRTEFAPQPSEMSNLTTNVNRIWIAPMPDTMPVKPRILENEKKKTTKLHAKKQPQLKPRRLIIIVTPTSTKLPHQAVFLRRLANTIKLVPQPLLWIVVEAKTNSTELPEILRKTGIMYRHVVFKENFTELEAELNHQRNLALKHIEHHRLNGIVHFAGLSNVYDLQFFHQLRDIEVFGTWPTALLAAHRKKVKIEGPVCDSSQVIGWHLRNMNNETDTITPPIHISSFAFNSSILWDPERWGRTSSVQDTSQNSIKFVKQVVLEDEAKLKGIPPEDCSKILLWRFNFRARTITNH*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo