Report for Sequence Feature Glyma19g36160
Feature Type: gene_model
Chromosome: Gm19
Start: 43509810
stop: 43512084
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma19g36160
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT3G53470 AT
Annotation by Michelle Graham. TAIR10: unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 35 Blast hits to 35 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr3:19822813-19823298 FORWARD LENGTH=135
SoyBase E_val: 1.00E-42 ISS
GO:0008150 GO-bp
Annotation by Michelle Graham. GO Biological Process: biological process
SoyBase N/A ISS
GO:0005739 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion
SoyBase N/A ISS
GO:0009507 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: chloroplast
SoyBase N/A ISS
GO:0009535 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
UniRef100_I1NA51 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NA51_SOYBN
SoyBase E_val: 9.00E-100 ISS
UniRef100_Q10N24 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Expressed protein n=2 Tax=Oryza sativa RepID=Q10N24_ORYSJ
SoyBase E_val: 7.00E-38 ISS
Expression Patterns of Glyma19g36160
Gene expression representations made with eFP at the University of Toronto. Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE Paralogs of Glyma19g36160
Paralog Evidence Comments
Glyma03g33430 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma19g36160 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.19g177900 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma19g36160
Coding sequences of Glyma19g36160
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma19g36160.1 sequence type=CDS gene model=Glyma19g36160 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGCAAATGGATGTTTATACACACATCTCATTACCATCTTTCATATCGCATCGCTTCTCTTCTTCACGATTCCAATGCTCATCACTTTCTTCTTATTCTCCTTTCAAGCTTGTCTGTTCCAACAGAGACTCCAAGGAATCTCAACGAAACGACGATAACAATAACAAGGGTGATAAATCTTCAACAGACTGGGACAAGGCATGGTCAAAATTCAAAAAGCAAGGGGGAAAAAAACCCTTCTCCAAATTTTCAGATAAGTATGTGAGCTGGAATCCTAAGCGTTCAGAGTTCCCTCTTTCTGAGGAGGTTGACCCTATCAAGAGAACAGAGAGATCAAACCTCAGTTTCTGGAATAGTCCAACTTTCACTTTAGGGGGTGCAATTATAATTGTCTTATTTCTTCTGTTGTACACCATTCTTGCACCAATCAAGTGA
Predicted protein sequences of Glyma19g36160
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma19g36160.1 sequence type=predicted peptide gene model=Glyma19g36160 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MQMDVYTHISLPSFISHRFSSSRFQCSSLSSYSPFKLVCSNRDSKESQRNDDNNNKGDKSSTDWDKAWSKFKKQGGKKPFSKFSDKYVSWNPKRSEFPLSEEVDPIKRTERSNLSFWNSPTFTLGGAIIIVLFLLLYTILAPIK*
SoyBase
SoyBase transitions to NEW site on 10/1/2024
