Glyma19g36150 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g36150

Feature Type:	gene_model
Chromosome:	Gm19
Start:	43504754
stop:	43507442
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g36150

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G20280	AT	Annotation by Michelle Graham. TAIR10: Zinc finger C-x8-C-x5-C-x3-H type family protein \| chr2:8740054-8742349 REVERSE LENGTH=371	SoyBase	E_val: 2.00E-104	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0003676	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding	SoyBase	N/A	ISS
GO:0008270	GO-mf	Annotation by Michelle Graham. GO Molecular Function: zinc ion binding	SoyBase	N/A	ISS
PTHR12681	Panther	ZINC FINGER-CONTAINING PROTEIN P48ZNF	JGI		ISS
UniRef100_B9SGS6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Zinc finger protein, putative n=1 Tax=Ricinus communis RepID=B9SGS6_RICCO	SoyBase	E_val: 1.00E-111	ISS
UniRef100_I1NA50	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NA50_SOYBN	SoyBase	E_val: 7.00E-123	ISS

Expression Patterns of Glyma19g36150

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g36150

Paralog	Evidence	Comments
Glyma03g33420	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g36150 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g177800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g36150

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g36150

Limit To All Plant Sequences

>Glyma19g36150.2   sequence type=CDS   gene model=Glyma19g36150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCCGCCGAAGCAGCAATCAAAAGCTGATCTTGTGAAGAAGCAGAAGATCGTTGAAGACAAAACCTTCGGTCTCAAAAACAAGAACAGGAGCAAAAATGTCCAGAAATACGTCCAGAACCTCAAGCAATACGTGCAACCTAAACTCGACCCTTCAAAACTCACTGCAAAGAAAAAGAAGGAAGAGAAGGCCAAGGACAAGGAGTTAAATGATTTGTTCAAAATTGCTGTTAGTCAGCCTAAGTCCATATTGTGTGAGTTTTTCAAAGTGGGGCAGTGTACCAAGGGCTTCAAGTGCAAGTTCTCCCATGATTTGAATGTTCAGAGGAAAGGGGAAAAATTGACCTTTATAGTGATAAAAACAATGGAGGATTGGGATCAAGACACCTTGGAGAAGGTTGTAGAGTCTAAGAAAACCGAGTATAATCAGAACAAACCAACTGACATGGTAAGTCTGTACTTTTTGGACACAGTGGAGAAGAAGCAATATGGTTGGTTCTGGGTCTGCCCCAATGGCAGTAAGAATTGCCACTATAGACATGCCCTTCCCCTTGGATATGTTTTGAAATCTCAAATGAAGGCTCTATTAGAGGAGGAAAGTGAAAAAATAACAATAGAGGAGGAGATTGAAAATCAGGCGAATGGTAATGCTACCGAAGATGGTCCTGGCACCTCAATAGCTAGTGCTGATGTTGACGATACTGACGATGTTGATGGCGAACTGGACATGGACGAGTTGGATGAATTAAGCAAGCTTATCAAAGATATCAATTCAAATAAAGGAGTAAGGAGCTGA

Predicted protein sequences of Glyma19g36150

Limit To All Plant Sequences

>Glyma19g36150.2   sequence type=predicted peptide   gene model=Glyma19g36150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MPPKQQSKADLVKKQKIVEDKTFGLKNKNRSKNVQKYVQNLKQYVQPKLDPSKLTAKKKKEEKAKDKELNDLFKIAVSQPKSILCEFFKVGQCTKGFKCKFSHDLNVQRKGEKLTFIVIKTMEDWDQDTLEKVVESKKTEYNQNKPTDMVSLYFLDTVEKKQYGWFWVCPNGSKNCHYRHALPLGYVLKSQMKALLEEESEKITIEEEIENQANGNATEDGPGTSIASADVDDTDDVDGELDMDELDELSKLIKDINSNKGVRS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain