SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g35800

Feature Type:gene_model
Chromosome:Gm19
Start:43266802
stop:43270156
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma19g35800
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G53570AT Annotation by Michelle Graham. TAIR10: FUS3-complementing gene 1 | chr3:19861449-19864125 REVERSE LENGTH=467 SoyBaseE_val: 4.00E-130ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006468GO-bp Annotation by Michelle Graham. GO Biological Process: protein phosphorylation SoyBaseN/AISS
GO:0045727GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of translation SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0004672GO-mf Annotation by Michelle Graham. GO Molecular Function: protein kinase activity SoyBaseN/AISS
GO:0004674GO-mf Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine kinase activity SoyBaseN/AISS
GO:0004713GO-mf Annotation by Michelle Graham. GO Molecular Function: protein tyrosine kinase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0016301GO-mf Annotation by Michelle Graham. GO Molecular Function: kinase activity SoyBaseN/AISS
GO:0016772GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups SoyBaseN/AISS
KOG0659 KOG Cdk activating kinase (CAK)/RNA polymerase II transcription initiation/nucleotide excision repair factor TFIIH/TFIIK, kinase subunit CDK7 JGI ISS
PTHR24058Panther DUAL SPECIFICITY PROTEIN KINASE JGI ISS
PTHR24058:SF30Panther JGI ISS
PF00069PFAM Protein kinase domain JGI ISS
UniRef100_D7LUJ7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Fus3-complementing gene 1 n=1 Tax=Arabidopsis lyrata subsp. lyrata RepID=D7LUJ7_ARALL SoyBaseE_val: 2.00E-127ISS
UniRef100_I1NA12UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NA12_SOYBN SoyBaseE_val: 3.00E-170ISS

Expression Patterns of Glyma19g35800
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g35800
ParalogEvidenceComments
Glyma03g33100 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g35800 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g174500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma19g35800
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma19g35800
>Glyma19g35800.2   sequence type=CDS   gene model=Glyma19g35800   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTACTGCAAGCAGGAGGTTAGGAATGGAATGGTTCCAAACCATGCTTATCCATTTGTGTTTTACAGGGGAATGCCACGCAATGGTTGTTCGCTCAAGTACCGTGAGGCTGCAAGGACTGAAGTTGAAGTCTGGTTGAGGCTAGCCAGACATGATGTTGACGGTGCACGTTGTGTGCAGATACGGAATTGGTTTGACTATCTTAATCATATTTGTATTGTATTTGAGAAGCTTGGACCAAGCTTATACGATTTTCTCCGCAAAAACAATTATCGTTCTTTATCAATTGATCTTGTTCGGGAGTTTGGCAGACAACTTTTGGAGTCTGTAGCATTTATGCATCACACTGATTTGAAGCCAGAGAACATTCTTCTTGTCTCATCAGAATTCATTAAAGTGCCAGACTATAAGTTTCTATCACGGAACACAAAAGATGGCTCCTATTTCAAGAATCTACCCAAGTGTCTTGGGTGGAACTATGATCTTTGGAGTGTGGGCTGCATACTGGTTGTTGAGCTTTGCTCTGGAGAGGCAGTTTTCCAAACACATGAGAACTTGGAACATCTTGCCATGATGGAGAGAGTTTTAGAACCACTACCTCCGAATATGGTGGTCAGGGTCGAAGGTACACGATTAAGTTGGCCTGATAGTTCAACTTCAAGAGAAAGCATGAGAGCAGTTTGGAAATTGCCACAGTTGCCGAACCTCATAAGGCAGCATGTTGATCATTCTGCTGGCGATTTGATTGACCTCTTGCAAGGGCTTCTGAGGTACGACCCTTCAGAACCACTTAAAGCTAAGGAAGCAATGAGACACCACTTCTTCTTCACAAGAGATACTAAAAGATATGGTTACCCTTTATAA
Predicted protein sequences of Glyma19g35800
>Glyma19g35800.2   sequence type=predicted peptide   gene model=Glyma19g35800   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MYCKQEVRNGMVPNHAYPFVFYRGMPRNGCSLKYREAARTEVEVWLRLARHDVDGARCVQIRNWFDYLNHICIVFEKLGPSLYDFLRKNNYRSLSIDLVREFGRQLLESVAFMHHTDLKPENILLVSSEFIKVPDYKFLSRNTKDGSYFKNLPKCLGWNYDLWSVGCILVVELCSGEAVFQTHENLEHLAMMERVLEPLPPNMVVRVEGTRLSWPDSSTSRESMRAVWKLPQLPNLIRQHVDHSAGDLIDLLQGLLRYDPSEPLKAKEAMRHHFFFTRDTKRYGYPL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo