SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g35510

Feature Type:gene_model
Chromosome:Gm19
Start:43082843
stop:43087602
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma19g35510
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G29040AT Annotation by Michelle Graham. TAIR10: regulatory particle AAA-ATPase 2A | chr4:14312369-14314386 FORWARD LENGTH=443 SoyBaseE_val: 0ISS
GO:0006094GO-bp Annotation by Michelle Graham. GO Biological Process: gluconeogenesis SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006499GO-bp Annotation by Michelle Graham. GO Biological Process: N-terminal protein myristoylation SoyBaseN/AISS
GO:0006511GO-bp Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0006635GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid beta-oxidation SoyBaseN/AISS
GO:0007292GO-bp Annotation by Michelle Graham. GO Biological Process: female gamete generation SoyBaseN/AISS
GO:0009407GO-bp Annotation by Michelle Graham. GO Biological Process: toxin catabolic process SoyBaseN/AISS
GO:0009408GO-bp Annotation by Michelle Graham. GO Biological Process: response to heat SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009853GO-bp Annotation by Michelle Graham. GO Biological Process: photorespiration SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010015GO-bp Annotation by Michelle Graham. GO Biological Process: root morphogenesis SoyBaseN/AISS
GO:0010078GO-bp Annotation by Michelle Graham. GO Biological Process: maintenance of root meristem identity SoyBaseN/AISS
GO:0010311GO-bp Annotation by Michelle Graham. GO Biological Process: lateral root formation SoyBaseN/AISS
GO:0035266GO-bp Annotation by Michelle Graham. GO Biological Process: meristem growth SoyBaseN/AISS
GO:0042023GO-bp Annotation by Michelle Graham. GO Biological Process: DNA endoreduplication SoyBaseN/AISS
GO:0043161GO-bp Annotation by Michelle Graham. GO Biological Process: proteasomal ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0043248GO-bp Annotation by Michelle Graham. GO Biological Process: proteasome assembly SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0048232GO-bp Annotation by Michelle Graham. GO Biological Process: male gamete generation SoyBaseN/AISS
GO:0048364GO-bp Annotation by Michelle Graham. GO Biological Process: root development SoyBaseN/AISS
GO:0048367GO-bp Annotation by Michelle Graham. GO Biological Process: shoot development SoyBaseN/AISS
GO:0048827GO-bp Annotation by Michelle Graham. GO Biological Process: phyllome development SoyBaseN/AISS
GO:0048829GO-bp Annotation by Michelle Graham. GO Biological Process: root cap development SoyBaseN/AISS
GO:0051510GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of unidimensional cell growth SoyBaseN/AISS
GO:0051788GO-bp Annotation by Michelle Graham. GO Biological Process: response to misfolded protein SoyBaseN/AISS
GO:0060968GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of gene silencing SoyBaseN/AISS
GO:0080129GO-bp Annotation by Michelle Graham. GO Biological Process: proteasome core complex assembly SoyBaseN/AISS
GO:0090351GO-bp Annotation by Michelle Graham. GO Biological Process: seedling development SoyBaseN/AISS
GO:0000502GO-cc Annotation by Michelle Graham. GO Cellular Compartment: proteasome complex SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0008540GO-cc Annotation by Michelle Graham. GO Cellular Compartment: proteasome regulatory particle, base subcomplex SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0016787GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity SoyBaseN/AISS
GO:0016887GO-mf Annotation by Michelle Graham. GO Molecular Function: ATPase activity SoyBaseN/AISS
GO:0017111GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleoside-triphosphatase activity SoyBaseN/AISS
KOG0726 KOG 26S proteasome regulatory complex, ATPase RPT2 JGI ISS
PTHR23073Panther 26S PROTEASE REGULATORY SUBUNIT JGI ISS
PTHR23073:SF9Panther 26S PROTEASE REGULATORY SUBUNIT 4 JGI ISS
PF00004PFAM ATPase family associated with various cellular activities (AAA) JGI ISS
UniRef100_E9RGY2UniRef Annotation by Michelle Graham. Most informative UniRef hit: Regulatory particle triple-A ATPase 2 n=1 Tax=Sophora flavescens RepID=E9RGY2_SOPFL SoyBaseE_val: 0ISS
UniRef100_UPI000189D0C3UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000189D0C3 related cluster n=1 Tax=unknown RepID=UPI000189D0C3 SoyBaseE_val: 0ISS

Expression Patterns of Glyma19g35510
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g35510
ParalogEvidenceComments
Glyma03g32800 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g35510 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g171700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma19g35510
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma19g35510
>Glyma19g35510.1   sequence type=CDS   gene model=Glyma19g35510   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGTCAGGGAACACCGGGCGGTCTGAACCGGCAGGGTCTTCCGGGGGACCGGAAGCCGGACGGCGGCGACAAGAAGGAGAAGAAGTTCGAGCCGGCGGCGCCGCCGGCCCGCGTGGGCCGTAAGCAGCGTAAGCAGAAGGGCCCGGAGGCGGCGGCGCGGCTGCCGACGGTGACGCCGCTGTCGAAGTGCAAGCTAAGGCTGCTGAAGCTGGAGCGCATAAAGGACTACCTCTTGATGGAGGAGGAGTTCGTGGCGAACCAGGAGAGGCTGAAGCCGCAGGAGGAGAAGGCCGAGGAAGACAGATCCAAGGTCGATGATCTCCGAGGTTCTCCTATGAGCGTTGGTAACCTAGAGGAACTCATTGACGAGAGTCATGCCATAGTTTCGTCCTCGGTGGGGCCCGAGTACTATGTTGGTATCTTGTCTTTCGTCGATAAGGATCAGCTCGAGCCTGGATGCGCTATTTTGATGCATAACAAGGTTCTCTCTGTTGTTGGGCTTCTTCAAGATGAAGTTGATCCAATGGTCTCTGTTATGAAGGTTGAAAAGGCACCTTTGGAATCATATGCTGATATTGGTGGTTTAGATGCTCAGATACAGGAAATTAAAGAAGCAGTCGAACTTCCCCTGACGCATCCTGAACTGTATGAAGACATTGGTATCAAGCCTCCTAAGGGAGTCATTTTATACGGCGAACCTGGAACTGGGAAGACGTTGCTAGCTAAGGCTGTGGCAAACTCGACATCAGCAACCTTTTTACGTGTTGTTGGTAGTGAATTAATACAAAAATACTTGGGAGATGGTCCAAAACTTGTAAGGGAACTTTTCCGAGTTGCTGATGATCTTTCCCCATCTATTGTCTTCATTGATGAAATTGATGCCGTTGGTACAAAGAGGTATGATGCCCACTCAGGTGGAGAACGTGAAATTCAGAGGACTATGTTGGAGTTGCTGAACCAGTTAGATGGTTTCGATTCAAGAGGTGATGTTAAAGTGATTCTTGCAACCAACAGAATTGAAAGCCTTGATCCAGCCCTGCTGCGACCTGGTCGAATTGACAGGAAGATTGAATTTCCTCTCCCTGATATCAAAACAAGAAGACGCATTTTCCAGATACATACTTCAAGGATGACATTAGCTGATGATGTCAACTTAGAAGAATTTGTTATGACTAAGGATGAGTTCTCTGGAGCTGATATAAAAGCAATATGTACTGAAGCTGGCTTACTTGCTTTACGAGAACGCCGGATGAAGGTGACGCATGCCGACTTCAAGAAGGCAAAGGATAAGGTTATGTTTAAGAAGAAAGAAGGGGTGCCAGAAGGACTGTATATGTGA
Predicted protein sequences of Glyma19g35510
>Glyma19g35510.1   sequence type=predicted peptide   gene model=Glyma19g35510   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGQGTPGGLNRQGLPGDRKPDGGDKKEKKFEPAAPPARVGRKQRKQKGPEAAARLPTVTPLSKCKLRLLKLERIKDYLLMEEEFVANQERLKPQEEKAEEDRSKVDDLRGSPMSVGNLEELIDESHAIVSSSVGPEYYVGILSFVDKDQLEPGCAILMHNKVLSVVGLLQDEVDPMVSVMKVEKAPLESYADIGGLDAQIQEIKEAVELPLTHPELYEDIGIKPPKGVILYGEPGTGKTLLAKAVANSTSATFLRVVGSELIQKYLGDGPKLVRELFRVADDLSPSIVFIDEIDAVGTKRYDAHSGGEREIQRTMLELLNQLDGFDSRGDVKVILATNRIESLDPALLRPGRIDRKIEFPLPDIKTRRRIFQIHTSRMTLADDVNLEEFVMTKDEFSGADIKAICTEAGLLALRERRMKVTHADFKKAKDKVMFKKKEGVPEGLYM*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo