SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma19g34120

Feature Type:gene_model
Chromosome:Gm19
Start:41732317
stop:41737154
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G63250AT Annotation by Michelle Graham. TAIR10: homocysteine methyltransferase 2 | chr3:23370575-23372587 REVERSE LENGTH=333 SoyBaseE_val: 0ISS
GO:0000394GO-bp Annotation by Michelle Graham. GO Biological Process: RNA splicing, via endonucleolytic cleavage and ligation SoyBaseN/AISS
GO:0006260GO-bp Annotation by Michelle Graham. GO Biological Process: DNA replication SoyBaseN/AISS
GO:0006306GO-bp Annotation by Michelle Graham. GO Biological Process: DNA methylation SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0008283GO-bp Annotation by Michelle Graham. GO Biological Process: cell proliferation SoyBaseN/AISS
GO:0009086GO-bp Annotation by Michelle Graham. GO Biological Process: methionine biosynthetic process SoyBaseN/AISS
GO:0009616GO-bp Annotation by Michelle Graham. GO Biological Process: virus induced gene silencing SoyBaseN/AISS
GO:0010050GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative phase change SoyBaseN/AISS
GO:0033528GO-bp Annotation by Michelle Graham. GO Biological Process: S-methylmethionine cycle SoyBaseN/AISS
GO:0043687GO-bp Annotation by Michelle Graham. GO Biological Process: post-translational protein modification SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0051567GO-bp Annotation by Michelle Graham. GO Biological Process: histone H3-K9 methylation SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0008898GO-mf Annotation by Michelle Graham. GO Molecular Function: homocysteine S-methyltransferase activity SoyBaseN/AISS
KOG1579 KOG Homocysteine S-methyltransferase JGI ISS
PTHR21091Panther METHYLTETRAHYDROFOLATE:HOMOCYSTEINE METHYLTRANSFERASE RELATED JGI ISS
PTHR21091:SF6Panther 5-METHYLTETRAHYDROFOLATE:HOMOCYSTEINE METHYLTRANSFERASE JGI ISS
PF02574PFAM Homocysteine S-methyltransferase JGI ISS
UniRef100_F8QPI4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Selenocysteine methyltransferase n=1 Tax=Astragalus chrysochlorus RepID=F8QPI4_9FABA SoyBaseE_val: 0ISS
UniRef100_I1N9J8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N9J8_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma03g31281 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g158800 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma19g34120.1   sequence type=CDS   gene model=Glyma19g34120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCGTCGTTGATAACAGATTTGCTCCGTCAAACCGGCGGCACCGCCGTCATCGACGGCGGTCTGGCGACGGAGCTGGAGCGCCATGGCGCCGACCTCAATGATCCTCTTTGGAGCGCCAAGTGCCTCTTTTCCTTCCCTCACCTCATTCGCCAAGTGCACCTTGATTACCTGGAAAATGGTGCAGACATTATAATCACAGCATCTTACCAAGCCACCATTCAAGGGTTTAAAGCCAAAGGCTATTCTGATGAAGAGAGTGAAGCCTTGCTCAGAAGCAGTGTTGAAATTGCACGGGAGGCACGCGAAGTTTACTATAAAAATTGTGCTGGATGTCGTTCGGGTGATGGGGATGATGATGGTAGAATCCTCAAACAACGGCCTATCTTGGTTGCTGCATCAGTAGGGAGCTATGGGGCTTATTTGGCCGACGGGTCAGAGTACAGTGGGGATTATGGTGATGCTATCACGGTGGAAACTCTTAAAGATTTTCATCGGAGAAGAGTTCAAATTTTAGCAGATTCAGGTGCTGACCTGCTTGCATTTGAAACAGTTCCCAATAAGCTTGAAGCTGAGGCTTATGCTCAGCTTCTGGAAGAAGAGGACATAAAAATTCCTGCATGGTTTTCTTTTAACTCTAAGGATGGAGTTAATGTTGTTAGCGGTGATTCTTTAATGGAATGTGGCTCTATTGCTGAATCATGTAATAAAGTTGTCGCTGTTGGAATCAACTGTACTCCACCAAGATTTATTCATGGTCTGATTGTTTTGCTTAAGAAGGTGACTACAAAACCAATTGTTATATATCCAAACAGTGGGGAAACTTACGATGCTGACCTAAAGGAGTGGGTGCAAAATACTGGTGTTACAGATGAAGATTTTATCTCATATGTAAATAAATGGTGTGAGTTAGGAGCTTCCCTTGTAGGTGGCTGTTGCAGAACGACTCCGGATACTATTAGGAAGATATACAGGACCCTGTCTAGCAGTCAATCAATCTAA

>Glyma19g34120.1   sequence type=predicted peptide   gene model=Glyma19g34120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSSLITDLLRQTGGTAVIDGGLATELERHGADLNDPLWSAKCLFSFPHLIRQVHLDYLENGADIIITASYQATIQGFKAKGYSDEESEALLRSSVEIAREAREVYYKNCAGCRSGDGDDDGRILKQRPILVAASVGSYGAYLADGSEYSGDYGDAITVETLKDFHRRRVQILADSGADLLAFETVPNKLEAEAYAQLLEEEDIKIPAWFSFNSKDGVNVVSGDSLMECGSIAESCNKVVAVGINCTPPRFIHGLIVLLKKVTTKPIVIYPNSGETYDADLKEWVQNTGVTDEDFISYVNKWCELGASLVGGCCRTTPDTIRKIYRTLSSSQSI*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo