Glyma19g34071 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g34071

Feature Type:	gene_model
Chromosome:	Gm19
Start:	41687436
stop:	41690541
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g34071

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G03110	AT	Annotation by Michelle Graham. TAIR10: Transducin/WD40 repeat-like superfamily protein \| chr1:749359-751796 FORWARD LENGTH=427	SoyBase	E_val: 2.00E-173	ISS
GO:0001510	GO-bp	Annotation by Michelle Graham. GO Biological Process: RNA methylation	SoyBase	N/A	ISS
GO:0006400	GO-bp	Annotation by Michelle Graham. GO Biological Process: tRNA modification	SoyBase	N/A	ISS
GO:0008618	GO-bp	Annotation by Michelle Graham. GO Biological Process: 7-methylguanosine metabolic process	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0000166	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotide binding	SoyBase	N/A	ISS
KOG3914	KOG	WD repeat protein WDR4	JGI		ISS
PTHR16288	Panther	WD40 REPEAT PROTEIN 4	JGI		ISS
PF00400	PFAM	WD domain, G-beta repeat	JGI		ISS
UniRef100_B9SFJ3	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: WD-repeat protein, putative n=1 Tax=Ricinus communis RepID=B9SFJ3_RICCO	SoyBase	E_val: 0	ISS
UniRef100_UPI000233F156	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233F156 related cluster n=1 Tax=unknown RepID=UPI000233F156	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma19g34071

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g34071 not represented in the dataset	Glyma19g34071 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g34071

Paralog	Evidence	Comments
Glyma03g31220	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g34071 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g158200	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g34071

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g34071

Limit To All Plant Sequences

>Glyma19g34071.1   sequence type=CDS   gene model=Glyma19g34071   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGCATGGAATCCGAATCCAAGAACGACACCGAAGTCGCTCCGGCCTTAATCGCCGTTCACCCCGACCAATCCTCCGTCGCCGTCGCTGTGGGCCCGCACCTCCGCGTCTTCGACCTCCTTAGCGGTTCTGCAGCTTCTTTAACCGACGATTCTGATTGCGCCCCGCTCCATAAGAACAACATCAGAGCCATTCGCTTCGGCGCCAAAGGAAAACTATTCGTGTCCGCCGGTGACGATAAAACAGTCAAGGTCTGGTCAACACAGTCCTGGCGTTGCATCACCACCGTGTCCTCCGAGAAGAGAGTTACTGCAGTTGCAATTAGCAACGACGGAACATTCGTGTGCTTCGCCGACAAATTCGGCGTTGTTTGGGTTGTGGATGTTGATCCTCCGTTACACGATAAGAAACCGGCACCGCTTCTTTCTCACTATTGCAGTATCATCACTAGCTTGGAATTTTCACCGGATGGTCGTTTTATTTTAAGCGCCGATCGTGATTTCAAAATTCGCGTTACTAATTTTCCCCAGAAGCCCTTAAATGGAGCTCACCAGATACAAAGTTTCTGTCTCGGTCATACAGAGTTTGTTTCCTGCCTTGCCTTCATTCAGGCTCAGGAATGCCCTCAAGGCCTTCTTCTCTCTGGCAGTGGTGATTCCACAGTTCGATTGTGGAATATTGACTCTGGAGCACTTCTAGATACTTGTGAGGTTGCAATCAAGGCAGGGCTTTTAGAGTCTAATGGTAAAGCAGAGGAGCATGGCCATGCTGTTATTGATTTATGCACTGTCCTGGATGGTTTGATTGTTGCAGTGGCCATTCAGAGCTTGCAAGGAATAGTATTGCTGAGTTGCAATGTTTGTGCACAAACTCTTTCTTTTGCCAAGGTGGTTTCTGTTGCTGGAGAGGCCTTTGTCCCTACCTGCTTGGGGAGCAGCCCCTCTATAAGGAAATTGTGGATGGTTACAGGTGTCTCTGGTCTACCTGGTTGTAATTATCTCTCTTTGGCTCGTGTGCGAGTAATTTCTGGTATTGATGTTGAGCAAGAGCCAGTTGTTCCGGGAGATGATAACATACCCGGGGGAGAAAAACTACTAGAAACGCTGCAAGGATCTGCATCCGTTGATGACAGTGCTTTTCTAGCAACAGCTGAAGCTGTCAAAACAGCAATGTGCAACCTATTGATAAAAAAACAATACCCTTCAGAGAATAGAGAATATAGGAAGAAAAGCAGAAATGATAGAAAACTAAAGGGCTAG

Predicted protein sequences of Glyma19g34071

Limit To All Plant Sequences

>Glyma19g34071.1   sequence type=predicted peptide   gene model=Glyma19g34071   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSMESESKNDTEVAPALIAVHPDQSSVAVAVGPHLRVFDLLSGSAASLTDDSDCAPLHKNNIRAIRFGAKGKLFVSAGDDKTVKVWSTQSWRCITTVSSEKRVTAVAISNDGTFVCFADKFGVVWVVDVDPPLHDKKPAPLLSHYCSIITSLEFSPDGRFILSADRDFKIRVTNFPQKPLNGAHQIQSFCLGHTEFVSCLAFIQAQECPQGLLLSGSGDSTVRLWNIDSGALLDTCEVAIKAGLLESNGKAEEHGHAVIDLCTVLDGLIVAVAIQSLQGIVLLSCNVCAQTLSFAKVVSVAGEAFVPTCLGSSPSIRKLWMVTGVSGLPGCNYLSLARVRVISGIDVEQEPVVPGDDNIPGGEKLLETLQGSASVDDSAFLATAEAVKTAMCNLLIKKQYPSENREYRKKSRNDRKLKG*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain