SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma19g33300): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma19g33300): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma19g33300

Feature Type:gene_model
Chromosome:Gm19
Start:40932421
stop:40933870
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma19g33300
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G42500AT Annotation by Michelle Graham. TAIR10: Disease resistance-responsive (dirigent-like protein) family protein | chr5:16994359-16994916 REVERSE LENGTH=185 SoyBaseE_val: 1.00E-62ISS
GO:0006952GO-bp Annotation by Michelle Graham. GO Biological Process: defense response SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PTHR21495Panther NUCLEOPORIN-RELATED JGI ISS
PF03018PFAM Dirigent-like protein JGI ISS
UniRef100_I1N9C1UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N9C1_SOYBN SoyBaseE_val: 7.00E-131ISS
UniRef100_Q45W75UniRef Annotation by Michelle Graham. Most informative UniRef hit: Disease resistance-responsive family protein n=1 Tax=Arachis hypogaea RepID=Q45W75_ARAHY SoyBaseE_val: 1.00E-76ISS

Expression Patterns of Glyma19g33300
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g33300 not represented in the dataset
Glyma19g33300 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma19g33300 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g151000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma19g33300
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma19g33300
>Glyma19g33300.1   sequence type=CDS   gene model=Glyma19g33300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCAACACCAAACACCTCACATTTACTTTCACCATCGTTCTCACGCTCCTCTTCTCATTCGCCACAGCAAAATCCCCAACGGCTTTGGGTGTCCAGAAGGAGAAGCTCAGCCACCTTCACTTCTTCTTCCACGACATAGTGAGCGGTCCAAAGCCCACCGCGGTGAGAGTGGCCCAGGCCCACATGACCAACACCTCCTCCACGCTTTTCGGGCTCCTGATGATGGCCGACGACCCATTGACCGTGGGCCCCGAGCCCGGGTCCAAACTCGTGGGAAAGGCCCAAGGAATTTACGGATTTGCGTCCCAGGAAGATATGGGTTTATTGATGATCATGAATTTCGCGTTCACCGAAGGGAAATACAATGGCAGCACACTAAGCTTGTTGGGGTGGAACGCGGTGTTGTCCACCGTGAGGGAGATGCCAATAGTTGGAGGAAGCGGGGCTTTCCGGTTCGCACGTGGGTATGCTCAGGCCAAGACTCACACGGTTGATTACAAGACAGGGGATGCTGTCGTGGAGTACAACGTCTACGTGCTCCATTATTAA
Predicted protein sequences of Glyma19g33300
>Glyma19g33300.1   sequence type=predicted peptide   gene model=Glyma19g33300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MANTKHLTFTFTIVLTLLFSFATAKSPTALGVQKEKLSHLHFFFHDIVSGPKPTAVRVAQAHMTNTSSTLFGLLMMADDPLTVGPEPGSKLVGKAQGIYGFASQEDMGLLMIMNFAFTEGKYNGSTLSLLGWNAVLSTVREMPIVGGSGAFRFARGYAQAKTHTVDYKTGDAVVEYNVYVLHY*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo