SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Notice: fwrite(): Write of 157 bytes failed with errno=28 No space left on device in /var/www/html/include/SeqFeatClass.php on line 369

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma19g33210): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma19g33210): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma19g33210

Feature Type:gene_model
Chromosome:Gm19
Start:40823339
stop:40832377
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G58060AT Annotation by Michelle Graham. TAIR10: Cation efflux family protein | chr3:21497778-21499676 REVERSE LENGTH=411 SoyBaseE_val: 3.00E-167ISS
GO:0006812GO-bp Annotation by Michelle Graham. GO Biological Process: cation transport SoyBaseN/AISS
GO:0055085GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane transport SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0016021GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane SoyBaseN/AISS
GO:0008324GO-mf Annotation by Michelle Graham. GO Molecular Function: cation transmembrane transporter activity SoyBaseN/AISS
GO:0015562GO-mf Annotation by Michelle Graham. GO Molecular Function: efflux transmembrane transporter activity SoyBaseN/AISS
KOG1485 KOG Mitochondrial Fe2+ transporter MMT1 and related transporters (cation diffusion facilitator superfamily) JGI ISS
PTHR11562Panther CATION EFFLUX PROTEIN/ ZINC TRANSPORTER JGI ISS
PTHR11562:SF10Panther ZINC TRANSPORTER SLC30A1-RELATED JGI ISS
PF01545PFAM Cation efflux family JGI ISS
UniRef100_B9T072UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cation efflux protein/ zinc transporter, putative n=1 Tax=Ricinus communis RepID=B9T072_RICCO SoyBaseE_val: 0ISS
UniRef100_UPI000233EFE4UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233EFE4 related cluster n=1 Tax=unknown RepID=UPI000233EFE4 SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g33210 not represented in the dataset

Glyma19g33210 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma03g30290 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g150000 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma19g33210.2   sequence type=CDS   gene model=Glyma19g33210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAGGTGGTTTGGATCATTTAAAGGCACCGTTTTTGTCAAGCAATAATAATGGTGAGCTCAGTGAAGTCACTCGTCTCAAATGCGATTTTTTCTCCAAATTGCCTGATAAGGTTCGGTGTGGTCTCGATCCTGAGCTCTCTTTTCACATTGACTACTCAAAGGCAACTGGCTTAACAAAAGGGGAGAAAGAGTATTACGAAAGGCAGTTTGCCACCCTAAGGTCTTTTGAGGAGGTTGATTCAACTGAATCTTCAAATGTCATTGAGGATGGGTCAGTGGATGCGGAACAAGTGCAGTCTGAAAGGGCAATGAAAATATCCAATTGGGCAAACGTTTTTTTACTCGCTTTTAAGAATCACACCTTACTGGTATTTGCAACAGTTAAGAGTGGTTCCATAGCTATTGCTGCATCAACACTGGATTCTCTGCTAGATCTTATGGCTGGTGAGTATCCCATTGGAAAATTGAGAATGCAACCGGTCGGCATTACCATCTTTGCCGCTATCATGGCTACATTGGGTTTTCAAGTGCTGGTTGAGGCCGTTCAACAATTGATTAAAGGAAAACCAACCTTGAAGATGACTTCAGATCAATTGTTTTGGTTGTATATAATCATGCTGATTGCCACTGGCGTAAAGCTTTTGCCCTGGTTGTATTGTAGAAGTTCAGGAAATAAAATAGCCGATCACTATTTTGATGTCATAACCAACATAGTTGGTTTGGTTGCTGCTGTCCTTGGTGATAAATTTAGTTGGTGGATTGACCCTATTGGCGCTATTTTGCTTGCACTCTATACAATTTCAAATTGGTCTAAAACTGTGCTTGAAAATGTTGTTTCCTTGGTTGGACAATCAGCTCCACCTGAAGTATTGCAGAAATTGACGTACCTTGTTTTAAGATACCATCCTCAAATCACACGTATTGACACAGTCCGTGCCTACACTTGTGGAGTTTTATACTTTGTTGAGGTGGACATAGAACTACCGGAGGATCTTCCACTGAAAGAAGCACATGCAATTGGAGAATCTTTGCAGATAAGGATCGAAGAACTCCCTGAAGTTGAGAGAGCCTTTGTTCATCTTGACACTGAATGCGAGCATAAGCCAGAGCACTCTGTTCTTAGCACTCTTCCCAGCAGCCAGATATAA

>Glyma19g33210.2   sequence type=predicted peptide   gene model=Glyma19g33210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEGGLDHLKAPFLSSNNNGELSEVTRLKCDFFSKLPDKVRCGLDPELSFHIDYSKATGLTKGEKEYYERQFATLRSFEEVDSTESSNVIEDGSVDAEQVQSERAMKISNWANVFLLAFKNHTLLVFATVKSGSIAIAASTLDSLLDLMAGEYPIGKLRMQPVGITIFAAIMATLGFQVLVEAVQQLIKGKPTLKMTSDQLFWLYIIMLIATGVKLLPWLYCRSSGNKIADHYFDVITNIVGLVAAVLGDKFSWWIDPIGAILLALYTISNWSKTVLENVVSLVGQSAPPEVLQKLTYLVLRYHPQITRIDTVRAYTCGVLYFVEVDIELPEDLPLKEAHAIGESLQIRIEELPEVERAFVHLDTECEHKPEHSVLSTLPSSQI*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo