Report for Sequence Feature Glyma19g33030
Feature Type: gene_model
Chromosome: Gm19
Start: 40688790
stop: 40693716
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma19g33030
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT3G12100 AT
Annotation by Michelle Graham. TAIR10: Cation efflux family protein | chr3:3854741-3857270 REVERSE LENGTH=393
SoyBase E_val: 4.00E-178 ISS
GO:0006812 GO-bp
Annotation by Michelle Graham. GO Biological Process: cation transport
SoyBase N/A ISS
GO:0009624 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to nematode
SoyBase N/A ISS
GO:0055085 GO-bp
Annotation by Michelle Graham. GO Biological Process: transmembrane transport
SoyBase N/A ISS
GO:0005794 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus
SoyBase N/A ISS
GO:0005886 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane
SoyBase N/A ISS
GO:0016020 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: membrane
SoyBase N/A ISS
GO:0016021 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane
SoyBase N/A ISS
GO:0008324 GO-mf
Annotation by Michelle Graham. GO Molecular Function: cation transmembrane transporter activity
SoyBase N/A ISS
GO:0015562 GO-mf
Annotation by Michelle Graham. GO Molecular Function: efflux transmembrane transporter activity
SoyBase N/A ISS
KOG1484
KOG
Putative Zn2+ transporter MSC2 (cation diffusion facilitator superfamily)
JGI ISS
PTHR11562 Panther
CATION EFFLUX PROTEIN/ ZINC TRANSPORTER
JGI ISS
PF01545 PFAM
Cation efflux family
JGI ISS
PF06813 PFAM
Nodulin-like
JGI ISS
UniRef100_G7KVE4 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Metal tolerance protein n=1 Tax=Medicago truncatula RepID=G7KVE4_MEDTR
SoyBase E_val: 0 ISS
UniRef100_I1N992 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N992_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma19g33030
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma19g33030
Paralog Evidence Comments
Glyma03g30140 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma19g33030 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.19g148200 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma19g33030
Coding sequences of Glyma19g33030
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma19g33030.1 sequence type=CDS gene model=Glyma19g33030 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGATTCTCTGACTTCCATCAACGGCGATTTCGGCTTCGCCGGCGGCACCGATCGCAGATTCGCGTTTTCGCGCCAAGCCTCCTTCCAACAGCCTCACACGCCGATAGACATTCCGGCGCACGGCCACCACTACTGGTCCGCGCGTGACGATAAACCCTCCTCCGCCTCGCTCCAAAGATCCTCTCTGTCCTCCTTCGTTTTCTCCGTTTTCCGAAACGTTAGGTCCGGCCACAGGTACATGAAGAGGCTCTTTCTCTTGATCTCGCTCAATGTCGCGTACTCCACCGCCGAATTGCTCTTTGGACTCTTCACCGGTCGCGTAGGTTTGGTGTCTGATGCGGTTCACTTGACTTTTGGATGTGGTCTTCTTACATTTTCGTTATTTGTTATGGCCGCGTCTAGGAAGAAAGCCGATCGAGAGTATACTTATGGGTATAAAAGGCTAGAAGTCTTGTCTGCATTTACAAATGCCCTATTTCTTTTGTTTATGTCATTCTCCCTAGCAGTTGAGGCACTTCATGCATTCATACAAGATGAATCAGAGCACAAGCATTACTTGATTGTTTCTGCAGTGACCAATTTATTTGTGAATCTTGTTGGTGTATGGTTCTTCAGAAACTATGCTCGGATTAATCTTGCTTACAGAAATGCAGAAGATATGAATCACCACTCTGTTTTCCTGCATGTTCTTGCAGATTCCATTCGCAGTGCAGGTCTGATATTGGCATCCTGGTTATTGTCAATTGGGGTTCAGAATGCAGAAGTCTTGTGTTTAGGACTTGTTTCTGTTGCAGTTTTTATGCTTGTTCTGCCTCTCTTTAGGGCAACTGGTGGTATCTTGCTCCAAATGGCACCTCCCAGCATCCCAACTACTGCTTTGAACAAATGCTTGAGACAGATTTCTGCTCGGGAAGATGTAATGGAAGTCTCCCAGGCTCGTTTTTGGGAATTAGTGCCTGGTTATGTGGTTGGTTCACTTATAATACAGGTAAAGAAAGGGACGAACGATCGGCCAATACTAGAATTTGTGCATGGTCTATACCATGATTTGGGTGTACAGGACCTCACGGTGCAAACTGATGATGCATGA
Predicted protein sequences of Glyma19g33030
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma19g33030.1 sequence type=predicted peptide gene model=Glyma19g33030 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MDSLTSINGDFGFAGGTDRRFAFSRQASFQQPHTPIDIPAHGHHYWSARDDKPSSASLQRSSLSSFVFSVFRNVRSGHRYMKRLFLLISLNVAYSTAELLFGLFTGRVGLVSDAVHLTFGCGLLTFSLFVMAASRKKADREYTYGYKRLEVLSAFTNALFLLFMSFSLAVEALHAFIQDESEHKHYLIVSAVTNLFVNLVGVWFFRNYARINLAYRNAEDMNHHSVFLHVLADSIRSAGLILASWLLSIGVQNAEVLCLGLVSVAVFMLVLPLFRATGGILLQMAPPSIPTTALNKCLRQISAREDVMEVSQARFWELVPGYVVGSLIIQVKKGTNDRPILEFVHGLYHDLGVQDLTVQTDDA*