Report for Sequence Feature Glyma19g32930
Feature Type: gene_model
Chromosome: Gm19
Start: 40622192
stop: 40623153
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma19g32930
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT3G12120 AT
Annotation by Michelle Graham. TAIR10: fatty acid desaturase 2 | chr3:3860592-3861743 REVERSE LENGTH=383
SoyBase E_val: 8.00E-154 ISS
GO:0006629 GO-bp
Annotation by Michelle Graham. GO Biological Process: lipid metabolic process
SoyBase N/A ISS
GO:0055114 GO-bp
Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0005783 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum
SoyBase N/A ISS
GO:0016717 GO-mf
Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water
SoyBase N/A ISS
GO:0016720 GO-mf
Annotation by Michelle Graham. GO Molecular Function: delta12-fatty acid dehydrogenase activity
SoyBase N/A ISS
GO:0045485 GO-mf
Annotation by Michelle Graham. GO Molecular Function: omega-6 fatty acid desaturase activity
SoyBase N/A ISS
PTHR19353 Panther
FATTY ACID DESATURASE 2
JGI ISS
PF00487 PFAM
Fatty acid desaturase
JGI ISS
PF11960 PFAM
Domain of unknown function (DUF3474)
JGI ISS
UniRef100_I1N981 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N981_SOYBN
SoyBase E_val: 0 ISS
UniRef100_Q19AK7 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Microsomal oleate desaturase FAD2-3 n=1 Tax=Glycine max RepID=Q19AK7_SOYBN
SoyBase E_val: 2.00E-171 ISS
Expression Patterns of Glyma19g32930
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Gene model name correspondences to Glyma19g32930 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.19g147300 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma19g32930
Coding sequences of Glyma19g32930
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma19g32930.1 sequence type=CDS gene model=Glyma19g32930 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGGTGACACTATGAAACGGGTGCCAATTGAAAAACCTCCATTTACTCTCAGCCAAATCAAGAAGGCTATTCCACCACACTTTTTCCAGCGTTCTGTTCTGCGCTCATTCTCATATCTCATTTATGACCTTACCATAGCCTTCTGCCTCTATTACATTGCCACCGATTACTTCCACAACCTTCCTCATCCTCTCACTTTCTTGGCATGGCCAATCTATTGGGCTGTGCAAGGATTCACCCTAGCTGGTCTTTGGGTCATTGCACATGACTGTGGCCACCATGCATTCAGAGATTACCAACTTCTTGATGATAACGTTGGCCTTGTTCTCCACTCTGCTCTATTAGTCCCATACTTTTCATGGAAATACAGCCATCGCCGTCACCACTCCAACACAGGTTCTCTTGAGCGAGATGAAGTGTTTGTACCAAAGCAGAAGTCTAGTATCAAGTGGCTATCTAAATACCTAAACAATCCACCAGGGAGAGTTTTCACACTTGCTGTTACCATCACACTCGGTTGGCCCATGTACCTAACTTTCAATGTTTCTTGTAGCAAAAGGGCTTGCCTGGGTGGTTTATGTTTATGGATTTCCAATGCTTGTGGTCAATGGGTGTTGGTCACAATCTTGCAGCACACTCACGCTGCATTGCCGCACTACAATTTCTCTGAGTGGGACTGGCTCAGAGGAGCTTTAGCAACAGTAGTGGATAGAGATTATGGAATCCTGAATAAGGTTCTCCATAATATTACAGGCACACATGTGGTGCATCACTTGTTCTCCACAATGCCACATTATCATGCAATGGACGCTACAAAGGCAATAAAGCCCATTTTGGGAGAGTATTATCGGTTTGACGAGACCCCATTTGTCAAGGCAATGTGGAGAGAGGCAAGAGAGTGTATTTATGTGGAACCAGATACTGAGAACAAA
Predicted protein sequences of Glyma19g32930
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma19g32930.1 sequence type=predicted peptide gene model=Glyma19g32930 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MGDTMKRVPIEKPPFTLSQIKKAIPPHFFQRSVLRSFSYLIYDLTIAFCLYYIATDYFHNLPHPLTFLAWPIYWAVQGFTLAGLWVIAHDCGHHAFRDYQLLDDNVGLVLHSALLVPYFSWKYSHRRHHSNTGSLERDEVFVPKQKSSIKWLSKYLNNPPGRVFTLAVTITLGWPMYLTFNVSCSKRACLGGLCLWISNACGQWVLVTILQHTHAALPHYNFSEWDWLRGALATVVDRDYGILNKVLHNITGTHVVHHLFSTMPHYHAMDATKAIKPILGEYYRFDETPFVKAMWREARECIYVEPDTENK