SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g32401

Feature Type:gene_model
Chromosome:Gm19
Start:40141923
stop:40144157
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma19g32401
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G55930AT Annotation by Michelle Graham. TAIR10: oligopeptide transporter 1 | chr5:22652988-22655827 FORWARD LENGTH=755 SoyBaseE_val: 1.00E-59ISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006820GO-bp Annotation by Michelle Graham. GO Biological Process: anion transport SoyBaseN/AISS
GO:0006857GO-bp Annotation by Michelle Graham. GO Biological Process: oligopeptide transport SoyBaseN/AISS
GO:0006862GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide transport SoyBaseN/AISS
GO:0006865GO-bp Annotation by Michelle Graham. GO Biological Process: amino acid transport SoyBaseN/AISS
GO:0006888GO-bp Annotation by Michelle Graham. GO Biological Process: ER to Golgi vesicle-mediated transport SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0015696GO-bp Annotation by Michelle Graham. GO Biological Process: ammonium transport SoyBaseN/AISS
GO:0015802GO-bp Annotation by Michelle Graham. GO Biological Process: basic amino acid transport SoyBaseN/AISS
GO:0043069GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death SoyBaseN/AISS
GO:0043090GO-bp Annotation by Michelle Graham. GO Biological Process: amino acid import SoyBaseN/AISS
GO:0043269GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of ion transport SoyBaseN/AISS
GO:0055085GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane transport SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
PTHR22601Panther ISP4 LIKE PROTEIN JGI ISS
PF03169PFAM OPT oligopeptide transporter protein JGI ISS
UniRef100_B9SWQ1UniRef Annotation by Michelle Graham. Most informative UniRef hit: Oligopeptide transporter, putative n=1 Tax=Ricinus communis RepID=B9SWQ1_RICCO SoyBaseE_val: 4.00E-89ISS
UniRef100_I1N932UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1N932_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma19g32401
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g32401 not represented in the dataset
Glyma19g32401 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g32401
ParalogEvidenceComments
Glyma03g29550 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g32401 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma19g32401
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma19g32401
>Glyma19g32401.1   sequence type=CDS   gene model=Glyma19g32401   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGACACGGGCCAGTAATAAGAAAGCATCACATCTCCCTTTGCAGCAATTCATTTCTGTTACCACCCCTCTTCTTGATTTGGAAAAGGAAGCTGAGGTATCAAGCTCAGGAGTGTCTCAAGAGAGGGTGGTCATAGAAGATGCTGAGAAAGATGAATTCAAAGTCAATGACTGTCCCATAGAGCAAGTAAGGCTAACAGTTCCAATCACTGATGATCCTACTCAGCCAGCACTGACATTCCGGACATGTGTTCTGGGGTTGGCATCATGTAACCAACCCTTTGAAAATCTCTTCGGTCTCGCGCCGATTATTACCCTCCCACTTGGGAAACTCATGGCTGCAACCCTTTCCACCAGACCAGTCCGAGTGCCATTCACAAAAGGGTCTTTTTTGTTGAATCCAGGGCCATTCTCTTTGAAGGAACATGTGCTGATCACCATCTTTGCTACCTCTGGATCTAGCGGTGTTTATGCAATTAACATCATCACAATTGTTAAGGCTTTTTATCATAGGAGCATCCATCCAGTAGCAGCTTATTTGTTAGCACTATCAACCCAAAGCTTGGGCATGAACAGCCTTGGCATCAGCTCATTTGGCCTCGATTGGAACACTGTTGCCGGCTTCTTAGGCAGTCCTTTAGCTATACCTGGCTTTGCCATCATCAACTTGTTGATTGGATTTGTGCTGGATATCTATGTGGTGATTCCTGTTGCTAATTGGAGCAATTTATATGATGCCAAAAAGTTTCCCCTCATTAGTTCTCACACGTTTGACTCTACTGGTGCAATATATAATGTTACTCGGATTCTAAATCCCATAACTTTTGAAATTGATTTGAATAGTTATAACAATTACAGCAAGATCTATCTTAGTAATGCATTTGTATTTGAGTATGGATTGGGCTTTGCAACTTTGATTGCCACTATTTCGCATGTTGCCCTCTTCCACGGGGAGATGATTCTTCAGGTGTGGAGGAAGACAACAAGAACACTAAAAGAACAACTTGGAGATCCTTCAAGATTTATGGACATGTCAGCATGTTACAAATTAGGCCACTATATGAAAATTCCTCCTAAAACTATGTTCATAGTGCAGCTGGTAGGCACAGTTGTTGCTTCATCTGTCCACTTTGCCACGGCTTGGTGGCTTCTCACGTCTATTGAGAACATTTGTGATGAAGCATTGTTGCCAAAGGGTAGTCCATGGACATGCCCTGGTGATGATGTGTTCTATAATGCTTCAATCATATGGGGAGTAGTAGGACCAAAGAGAATGTTCTCCAAGGATGGTGTTTATCCAGGGATGAATTGGTTTTTCCTTAATGGTCTACTAGCACCCCTTCCAGCGTGGTTGCTTTCTCGCAAATTCCCCAACCACAAGTGGATTCAACTCATCAACTTTCCCATCATCACTGCATGTGCATCCAATATCCCACCATTCAGATCTGAGTTATATTACATGGGGAATTGTTGGAATCTTCTTCAATTTTTATGTTTATAG
Predicted protein sequences of Glyma19g32401
>Glyma19g32401.1   sequence type=predicted peptide   gene model=Glyma19g32401   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
METRASNKKASHLPLQQFISVTTPLLDLEKEAEVSSSGVSQERVVIEDAEKDEFKVNDCPIEQVRLTVPITDDPTQPALTFRTCVLGLASCNQPFENLFGLAPIITLPLGKLMAATLSTRPVRVPFTKGSFLLNPGPFSLKEHVLITIFATSGSSGVYAINIITIVKAFYHRSIHPVAAYLLALSTQSLGMNSLGISSFGLDWNTVAGFLGSPLAIPGFAIINLLIGFVLDIYVVIPVANWSNLYDAKKFPLISSHTFDSTGAIYNVTRILNPITFEIDLNSYNNYSKIYLSNAFVFEYGLGFATLIATISHVALFHGEMILQVWRKTTRTLKEQLGDPSRFMDMSACYKLGHYMKIPPKTMFIVQLVGTVVASSVHFATAWWLLTSIENICDEALLPKGSPWTCPGDDVFYNASIIWGVVGPKRMFSKDGVYPGMNWFFLNGLLAPLPAWLLSRKFPNHKWIQLINFPIITACASNIPPFRSELYYMGNCWNLLQFLCL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo