Report for Sequence Feature Glyma19g31800
Feature Type: gene_model
Chromosome: Gm19
Start: 39578841
stop: 39584853
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma19g31800
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT2G41600 AT
Annotation by Michelle Graham. TAIR10: Mitochondrial glycoprotein family protein | chr2:17345597-17346701 REVERSE LENGTH=207
SoyBase E_val: 2.00E-54 ISS
GO:0008150 GO-bp
Annotation by Michelle Graham. GO Biological Process: biological process
SoyBase N/A ISS
GO:0005739 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion
SoyBase N/A ISS
GO:0005759 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial matrix
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
KOG2536
KOG
MAM33, mitochondrial matrix glycoprotein
JGI ISS
PF02330 PFAM
Mitochondrial glycoprotein
JGI ISS
UniRef100_G7KSM9 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Mitochondrial acidic protein mam33 n=1 Tax=Medicago truncatula RepID=G7KSM9_MEDTR
SoyBase E_val: 4.00E-88 ISS
UniRef100_I1N8Y3 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N8Y3_SOYBN
SoyBase E_val: 7.00E-170 ISS
Expression Patterns of Glyma19g31800
Gene expression representations made with eFP at the University of Toronto. Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE Paralogs of Glyma19g31800
Paralog Evidence Comments
Glyma03g29020 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma19g31800 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.19g136500 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma19g31800
Coding sequences of Glyma19g31800
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma19g31800.1 sequence type=CDS gene model=Glyma19g31800 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGATGTGCCGTAGGACGGAGTTGTATAGAGAGTTGAAGCAGCGTATCACACATCTTCGACATTTCTGCGACACGCAACAAAAACATCTTCAAGATCTCGAATTGCTCAAGTGCTTCAAATCTGAGATTCAATTCGAGCTTGCCTCTAATCACTTTCAGAATGCTCGAAGTGATTCCTCCTTAGGGGACTTTGTGGTGGACCCGAACTCACCCAGTTCCAAAGATGTGGTTTTGCGAAGAAAATTCGATTCGGGTGAGGAAATTGCAATTTCTGCTATTCTGGGACCTCCCAACTACGTGAAAGACCTTGTTTTTCCAAGGGATGCTTTTGTGAAAGTTTGTGTGAAAAAGCCAGCATTGAGCTCCATGTTGCAGTTTGACTGTGATGTTTATGAGGAAACTGATAAGGGCTCTGATTTTGACATCTACAATGCTTATTATCTCAGATCACCTACATGTCTCAGCCCTTCCATTTACAGAGGCCCTTTATTCCGCACATTGGATGATGAGTTGCAAGATGCTCTCAAGGAATACCTGATAGCCAAGGGCATTGGGGTAAGCCTGACCAATTTCCTTCTCCACTACCTACACAAAAGAGAGCATGAGCAGTACATGAACTGGTTGAAGAAAGGTGAAGCAGCATTCGTGGCAAAAGAAGGGTCATTGAGGGAATCATCAGAGTTACATTCTTGA
Predicted protein sequences of Glyma19g31800
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma19g31800.1 sequence type=predicted peptide gene model=Glyma19g31800 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MMCRRTELYRELKQRITHLRHFCDTQQKHLQDLELLKCFKSEIQFELASNHFQNARSDSSLGDFVVDPNSPSSKDVVLRRKFDSGEEIAISAILGPPNYVKDLVFPRDAFVKVCVKKPALSSMLQFDCDVYEETDKGSDFDIYNAYYLRSPTCLSPSIYRGPLFRTLDDELQDALKEYLIAKGIGVSLTNFLLHYLHKREHEQYMNWLKKGEAAFVAKEGSLRESSELHS*
SoyBase
SoyBase transitions to NEW site on 10/1/2024
