Report for Sequence Feature Glyma19g31395
Feature Type: gene_model
Chromosome: Gm19
Start: 39196521
stop: 39198063
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma19g31395
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT3G10190 AT
Annotation by Michelle Graham. TAIR10: Calcium-binding EF-hand family protein | chr3:3155309-3155938 FORWARD LENGTH=209
SoyBase E_val: 5.00E-57 ISS
GO:0008150 GO-bp
Annotation by Michelle Graham. GO Biological Process: biological process
SoyBase N/A ISS
GO:0005886 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane
SoyBase N/A ISS
GO:0005509 GO-mf
Annotation by Michelle Graham. GO Molecular Function: calcium ion binding
SoyBase N/A ISS
KOG0027
KOG
Calmodulin and related proteins (EF-Hand superfamily)
JGI ISS
PTHR10891 Panther
CALMODULIN
JGI ISS
PTHR10891:SF149 Panther
CALMODULIN-RELATED
JGI ISS
PF00036 PFAM
EF hand
JGI ISS
UniRef100_B9T832 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Calcium-binding allergen Ole e, putative n=1 Tax=Ricinus communis RepID=B9T832_RICCO
SoyBase E_val: 4.00E-62 ISS
UniRef100_UPI000233E75E UniRef
Annotation by Michelle Graham. Best UniRef hit: UPI000233E75E related cluster n=1 Tax=unknown RepID=UPI000233E75E
SoyBase E_val: 8.00E-156 ISS
Expression Patterns of Glyma19g31395
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma19g31395
Paralog Evidence Comments
Glyma03g28650 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma19g31395 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.19g132800 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma19g31395
Coding sequences of Glyma19g31395
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma19g31395.1 sequence type=CDS gene model=Glyma19g31395 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGAAGCTCATTAGCAGCATTAACCCCAAAAATCTCAAACTCAGTCCCAAACGCTTCTTTCGCAAAAAGGAACGATCTTTAGTCTCACGCTCCGACCCACCTTCATTCGGATCCGGATCTTCCTCCGACGACTCCACCACAAATCACAAGCCTTCCGCCGGTAACCAAACTCCGACCAGCGTCCTCCCGGGCGTCTCCGGAGACTGGTCCGACGTCGCCGCCGTCGACGTGCGGTGGGACCTCGCCCAGGCCTTCCGCCTCATCGACCGCGACAACGACGGCGTCGTCACGCGCCAGGACCTCGAGGCCCTCCTCACGTGCCTCGGCGCGTCGCCGTGCCCCGACGACGTGGCGGTCATGCTCGGCGAGGTCGACGGCGACGGCATCACCGTAGAAAGGCTCATGAGCTACGTCGGGTCGGGTCTGAAACCCGGGTCGGATCCGGACGAGCTCAAGGAGGCGTTCGAGGTGTTCGACACGGATCGCGACGGGAGGATCTCGGCGGAGGAGCTGCTTAGGGTTTTCAAGGCCATCGGCGACGAGCGGTGCACGTTAGAGGAGTGCCGGCGCATGATAGAGGGTGTGGACAGAAATGGGGACGGGTTCGTCTGCTTCGAGGACTTTTCTCGTATGATGGAGCTGCAGCAGCAGCGATGA
Predicted protein sequences of Glyma19g31395
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma19g31395.1 sequence type=predicted peptide gene model=Glyma19g31395 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MKLISSINPKNLKLSPKRFFRKKERSLVSRSDPPSFGSGSSSDDSTTNHKPSAGNQTPTSVLPGVSGDWSDVAAVDVRWDLAQAFRLIDRDNDGVVTRQDLEALLTCLGASPCPDDVAVMLGEVDGDGITVERLMSYVGSGLKPGSDPDELKEAFEVFDTDRDGRISAEELLRVFKAIGDERCTLEECRRMIEGVDRNGDGFVCFEDFSRMMELQQQR*